Volume 5, Issue 2 (May 2018)                   IJML 2018, 5(2): 113-122 | Back to browse issues page

XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Kamalabadi M, Astani A, Nemati F. Anti-viral Effect and Mechanism of Carvacrol on Herpes Simplex Virus Type 1. IJML 2018; 5 (2) :113-122
URL: http://ijml.ssu.ac.ir/article-1-196-en.html
Zoonotic Diseases Research Center, School of Public Health, Shahid Sadoughi University of Medical Sciences, Yazd, Iran. Department of Microbiology, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran.
Full-Text [PDF 276 kb]   (6243 Downloads)     |   Abstract (HTML)  (3551 Views)
Full-Text:   (5822 Views)
Introduction
Herpes viruses are a large family of DNA viruses with an icosahedral capsid and genomes encoding 100-200 genes. These viruses have similar morphology and replication and can make a latent and recurrent infection. Herpes simplex viruses are normal human pathogens with benign lesions but sometimes cause lethal diseases. Herpes simplex virus type 1 (HSV-1) is a member of this family which has a short growing cycle and the latency in neurons [1]. After initial infection, these viruses tend to remain dormant in sensory ganglia, so that if the patient is placed under adverse conditions such as stress, sun exposure, radiation, ultraviolet, pressure, fever, hormonal factors and so on, or the immune system is suppressed or weakened, latent virus becomes active. Primary infection occurs due to skin, mucous membranes and eye contact with infected secretions. The virus further causes wounds around the mouth, herpes labialis, scorpion disease, corneal inflamm-ation and encephalitis [1, 2].
Viral replication begins by binding virus to specific receptors. After penetration and removing the coverage, the genome is released and the expression of Immediate early, early and late last is done. Finally virus is accumulated and released, which can be accompanied by cell lysis. Two of the most important genes involved in virus replication process are early and late genes (UL52 and UL27, respectively) [3]. One of the drugs used in the treatment of injuries resulting from this virus is acyclovir. It is activated by viral thymidine which controls viral DNA polymerase and prevents viral replication in infected cells. Most chemical treatments against herpes simplex infections, which target viral proteins and involve in DNA synthesis, are almost successful in the treatment of infection caused by the virus. Nowadays, due to the mutant viruses without this enzyme, resistance to it especially in immuno-compromised people is increasing [2]. Therefore, the development of new drug compounds in order to treat diseases caused by herpes simplex virus is essential. Medicinal plants are appropriate choices for antiviral effect due to their low side effects on human. Carvacrol (2-methyl-5-1-methyl-ethyl phenol) is a phenol monoterpenoid that has shown by the previous studies to have a broad antimicrobial activity on pathogenic fungi, yeast, viruses, and bacteria [4]. Studies have indicated that monoterpenoid compounds such as carvacrol, in addition to savoring antimicrobial and anti-fungal activity are effective in anti-tumor and anti-cancer conditions [1, 5]. The antiviral effects on carvacrol has been tested on other viruses such as rotavirus and human respiratory syncytial virus [3]. In this study we investigated antiviral activity of this compound on HSV-1 and mechanism of the action of virus and its possible impact on the various stages of replication.
Materials and Methods
Carvacrol was prepared from department of physiology, in Shahid Sadoughi University of Medical Science, in Yazd, Iran. Stoke concentration was 1 mg/ml which was dissolved in dimethyl sulfoxide (DMSO) and for all experiments final concentration of DMSO was below 1% with no effect on virus and cells. Acyclovir was prepared from Amin Pharmaceutical Company in Iran and was dissolved in distilled water to make a stock concentration of 100 µM [6]. This study was approved by Ethics Committee of Shahid Sadoughi University of Medical Sciences, Yazd, Iran.
Provision and maintenance of cell lines
Vero cells (National Center of Genetic and Biological Resources, Iran) that were prepared under the supervision of Academic Center for Education, Culture and Research (ACECR) University, were grown in monolayer culture with Dulbecco´s Modified Eagle´s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin (all Gibco, Karlsruhe, Germany) and was kept in incubator with 5% CO2 at 37°C [6, 7].
Preparation and virus replication of HSV-1
HSV-1 strain KOS (Tarbiat Modares University, Iran) was used for experiments. HSV-1 stock cultures were prepared from supernat-ants of infected cells and were stored at -70°C. Infectivity titers were determined by a tissue culture infectivity dose (TCID50) method [8].
Cytotoxicity test
In order to achieve a concentration of drug which was nontoxic on vero cells, [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (MTT) test was used. In this test, cells were seeded into the 96 well plates. Plates were kept in incubator at 37°C with 5% CO2 for 24 hrs. Then, the cells were washed with preheated phosphate buffered saline (PBS), and serial dilution of carvacrol from 0.1% to 0.00001% was added to vero cells. After 48 hrs of incubation at 37°C, MTT dye uptake was determined by measuring the optical density at 570 nm in a spectro-photometer (Biotek Instrument Model: Box 998, United States). Wells containing medium with 1% DMSO were used as control [9].
Determine the viral titer by TCID50 method
To determine the appropriate concentration of the virus that makes pathological change in 50% of the cells, TCID50 method was used. Virus infectivity was quantified by estimating the 50% TCID50 using standard cell culture procedures. Briefly, when cells reached 80% confluency 96-well microtitre plates, six replicates were infected with 1.8 ml DMEM combination without serum as a diluents and 0.2 mol virus, and then were incubated for 1 hr at 37°C in a humidified atmosphere of 5% CO2 until viruses were absorbed into the cell. Afterwards, the media was removed and DMEM containing 2% FBS was added into 96-well plates and incubated for 48 hrs at 37°C. Cytophatic effect was checked by an inverted microscope (ACCU-SCOPE, United States) and infectivity titers were expressed as TCID50/ml based on the Karber formula. The virus infectivity was then compared and analyzed to determine the optimal sample formulation under the different conditions of preparation and storage [10, 11].
 
 
Antiviral activity
The antiviral activity of carvacrol was evaluated with TCID50 assay. Different concentration of the drug was incubated with virus for 1 hr at 25°C. Then the resulting compound was inoculated to the cells for 1 hr at 37°C, and then the cells were subjected to TCID50 assay. The 50% inhibitory concentration (IC50) of the compound was evaluated from dose response curves [12-14].
HSV-1 incubation with carvacrol prior to infect vero cells with virus
In this experiment, the ability of drugs to bind to the virus and change their ability to infect cells was tested. For this purpose, the desired concentration of HSV-1 virus with non-toxic concentrations of carvacrol was incubated for 1 hr at room temperature and then was added to the cells and removed from the cells and media containing 2% FBS was added to the cells. The results were recorded after 24 to 48 hrs by TCID50 assay [15]. Beta pinene was used as a monoterpene compound control which had been prepared from Carl Roth (Karlsruhe- Germany). This compound is solved in ethanol; during testing we noted that final ethanol concentration should not exceed 1%.
Treatment of vero cell before infecting cells with HSV-1
Drugs were examined for their ability to bind to cell receptors and to prevent the virus. For this purpose cells and drug were incubated for 1 hr at 37°C. Then the cells were washed and HSV-1 with defined concentration of carvacrol were added to the cells and were incubated for 1 hr at 37°C. Afterwards, the medium were removed, and DMEM medium containing 2% FBS were added and the cells were checked after two days.
Vero cell incubation with carvacrol after cell infection with HSV1
The ability of combination in affecting virus infection in intercellular were tested. After the penetration of the virus to infected cells, drug was added to cells. Wells containing medium with 1% DMSO but no compound were also used as control. After two days, cells were subjected to TCID50 assay [16].
Attachment assay
To determine antiviral effect of carvcrol on attachment of virus, vero cell monolayers were grown in 24-well culture plates and then prechilled at 4°C for 1 hr. After aspirating the medium, cells were infected with virus in the absence of the maximum noncytotoxic carvacrol concentrations. Then, cells were kept at 4°C for another 3 hrs. After removing the medium, cells were washed with PBS [17-19]. Finally, the effect of carvacrol on attachement was checked with TCID50 assay. Melissa officinalis with a stock concentration of 1.43 mg/ml was used as a positive control [16].
The evaluation of HSV-1 penetration to cells
To determine the effect of carvacrol on viral penetration, cells were prechilled at 4°C for 1 hr followed by infection with virus for 2 hrs at 4°C. Carvacrol was added for another 30 min. at 4°C. To allow viral penetration, the temperature of incubator was changed to 37°C. After 30 min. at 37°C, cells were treated with citrate buffer (135 mM NaCl, 10 nM KCl, 40 mM sodium citrate, pH 3) to stop penetration and to inactivate attached, unpenetrated virions. After removing the buffer, the cell was overlaid with medium and then the effect of carvacrol on penetration was checked with TCID50 assay [18].
Real Time polymerase chain reaction (RT-PCR)
The level of gene expression of late and early genes were determined by RT-PCR. For this purpose, vero cells were infected with HSV-1 in 24 well plates at 37°C for 1 hr, then cells were overlaid with medium and carvarol. Acyclovir was used as a control. After 48 hrs, the cellular RNA was extracted using a kit from RIBO-PREP Company (Moscow, Russia). Then, reverse transcription of RNA was performed by cDNA synthesis kit (Fermantas, USA), yielding cDNA. In the presence of specific primers, the cDNA was used for RT-PCR using SYBR green. The primer pairs for UL52 were forward (5′GACCGACGGGTGCGTTATT3′) and reverse (5′GAAGGAGTCGCCATTTAGCC3′); for UL27 were forward (5′GCCTTCTT CGCCTTTCGC3′) and reverse (5′CGCTCGTGCCCTTCTTCTT3′) [20]. Glyceral-dehyde 3-phosphate dehydro-genase (GAPDH) was used as the reference gene which primer pairs were GAPDH forward (5′CCCACTCCTCCACCTTTGAC3′) and GAPDH reverse (5′TCTTCCTCTT GTGCTCTTGC3′). Comparison of gene expressions was performed by the delta delta Ct method.
Results
The results of the toxicity of carvacrol on vero cells using MTT
The effect of different concentrations of the drug on vero cells MTT assay processed for 48 hrs led to, a desired result (TC50 was 0.001%).
Determination of 50% inhibitory concentra-tion of carvacrol against virus
In order to determine inhibitory concentration of carvacrol against virus, non-toxic drug with different concentrations of carvacrol was exposed to the virus and then was inoculated into the cells. The concentration range tested for carvacrol was up 0.00001% - 0.00075%, which was obtained by MTT assay. 50% of inhibitory concentration of carvacrol against virus was 0.0002% (Table 1).
Results of carvacrol antiviral mechanism against HSV-1
The results of virus titer by TCID50/ml was 104.5. Results show that carvacrol decreases herpes up to 70%. There was no reduction when drug enters the cell before entering the virus. The result showed that Carvacrol has no effect on replication. Carvacrol has no effect in attachment. Based upon data, carvacrol has no effect on penetration (Fig. 1).
The results of early and late virus gene expression of HSV-1
RT-PCR result revealed that this drug had no role in the early and late gene expression (Fig. 2).




Table 1. The results of the drug selectivity index 
Drug Max noncytotoxic concentration TC50 IC50 SI (TC50/IC50)a
Carvacrol 0.00075% 0.001% 0.0002% 5
Acyclovir 100 μm ≥ 100 μm 1.8 μm ≥ 56
a Selectivity index (SI) is the ratio of  TC50 and IC50.
TC50= 50% toxic concentration; IC50= 50% inhibitory concentration
 

Discussion

Herpes virus can cause lifelong infection. This infection is latent and is associated with reactivation. Many of the known human herpes viruses infect most of the world's population. HSV-1 leads to different clinical symptoms from hepetic labialis to an acute encephalitis in humans [1, 2]. Drug for the treatment of diseases caused by this virus is acyclovir. However, due to prolonged use of the drug, resistant strains of the drug have been identified. Acyclovir resistant strains can cause severe clinical consequences in patients [2].
The use of medicinal plants to treat and prevent various diseases has been widely growing. Recently, due to drug resistance and its side effects, use of drugs of plant origin for the treatment of diseases has increased. In this study, we tried to investigate the effect of carvacrol combination on HSV-1. Many other studies have been conducted to determine the effects of plant extracts on HSV-1. A study by Khanavi and colleagues in 2009 presented the chemical components of essential oils of thyme and oregano. It was found that essential oil of thyme twigs air contains 24 compounds including: thymol (38%), carvacrol (34.96%), p-cymene (7.17%) and beta-caryophyllene (2.71%) [21]. In another study by Cinati and colleagues it was shown that one of the constituents of licorice is carvacrol [22].
Based on this study and other studies by Mardani et al. [23], Farahani et al. [24], Sabouri Ghanad et al. [25] and Monouri et al. [26] on plant extract, our study was determined to check antiviral activity of carvacrol on vero cells. Carvacrol is a compound with the scientific name Methyl ethyl 2-methyl phenol 5-1 which has an anti-bacteria and anti-fungi effects. Magi et al. in 2015 showed the antimicrobial effect of carvacrol on Streptococcus pyogenes [27]. Maximum nontoxic concentration of this compound determined with MTT assay was 0.0001.
The antiviral effect of the drug was tested and IC50 was 0.0002. With TC50/IC50, selectivity index was calculated which was 5. According to the research that was conducted by Amoros et al. in 1992, the drugs with selectivity index higher than 4 are considered preferable [28]. Astani et al. worked on some essential oils and monoterpenoids and some of their selectivity indexes were as follows: Thyme oil: 6.4, Thymol: 2.8, Citral: 12.9 [29].
According to this study, carvacrol which belonged to monoterpenoids and one of the compounds of plants essential oils had similar selectivity index. In a study conducted by Mardani et al. in Iran in 2012, the antiviral effect of Shirazi thyme essential oils, was determined. Carvacrol was one of the compounds that its antiviral effect against HSV-1 was considered. In this pilot study, cytotoxicity of essential oils in different concentrations was performed on vero cells. The result showed that the concentration which destroyed 50% of vero cells was 0.0676, and the concentration which inhibited detection of viral plaque was 0.0059. Also tested essential oils in 0.01, 0.02 could prevent the virus completely [23]. Based on the previous studies, thyme essential oils can prevent the virus completely. In this study, carvacrol, as a part of thyme essential oils, reduced the virus up to 70%, so it showed that another compound of thyme essential oils has antiviral effect. The concentration used was 0.01 and 0.02 %. However, in this study the concentration of 0.00075% was inhibited by 70% that is a good result for carvacrol compound.
In another study which was performed by Farahani in 2012, the antiviral effect of thyme on HSV-1 was tested in vitro. The antiviral effect of this plant was considered by preventive effects of cytopatic virus. Thyme essential oils prevent herpes virus proliferation and in non-toxic concentration shows antiviral effect on HSV-1 [24].
Another study by Pilao and his colleagues on Mentha pulegium essential oils showed that carvacrol is the main compound thus its antiviral effect on human and animals was investigated. They concluded that these essential oils are able to inhibit different human and animal virus such as Rota virus, bovine diarrhea virus and respiratory syncytial virus in vitro [15]. In the next phase, drug mechanism has been considered. This experiment was performed in three methods: incubation of HSV-1 with carvacrol before infection with vero cells with the virus (Pretreatment of virus), treatment of vero cells with carvacrol before contaminating cells with HSV-1 (Pretreatment of cell), and incubation of vero cells with carvacrol after infecting the cells with HSV-1 (replication). Carvacrol shows 70% decrease in pretreatment of virus. In another study carried out by Monavari and colleagues on thyme essential oils in 2013, the antiviral effect of this extract against HSV-1 before infection cells with the virus was probed. In this article, Melissa and B-pinene were used as positive control which both showed 100% decrease [26].
In this study, in pretreatment of the cell, only Mellissa showed 60% decrease. In replication, carvacrol has no decrease because it cannot enter the cell while acyclovir, as a positive control, has 100% decrease which is due to its mechanism that affects on replication. After this stage, antiviral effect of carvacrol on penetration and attachment modes was checked which showed no inhibitory effect on virus. In final stage, primary and delay gene was checked by RT-PCR method, and it resulted in that carvacrol shows no change in none of them although acyclovir showed decrease for UL52 and UL27 40% and 20%, respectively. It means that it plays important role for gene expression decrease. We resulted that the use of plant drugs is more effective and has no side effects; carvacrol compound showed ant-viral effects in pretreatment process.
This study suggests that compounds such as Carvacrol and beta-pinene are monoterpenes and the synergism between them can be considered as a next step. We reached a good conclusion on low toxicity and anti-herpes virus by in vitro study. In vivo studies can be studied on animal laboratory.
Conflict of Interest
The authors declare that they have no competing interests.
Acknowledgment
There is no acknowledgment to declare.
 
 
 
References
  1. Brooks GF, Carroll KC, Butel JS, Morse SA. Medical microbiology. 24th ed, US: McGrawHill; 2007.
  2. Greenberg MS, Glick M. Burket`s oral medicine. 11th ed, USA: BC Decker Inc; 2008. pp. 42-46.
  3. Pilau MR, Hartz Alves S, Weiblen R, Arenhart S, Cueto AP, Lovato LT. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses. Brazil J Microbiol. 2011; 42(4): 1616-624.
  4. Woo SB, Greenberg MS. Ulcerative, vesicular and bullous lesions. In: Greenberg MS, Glick M, Ship JA, editors. Burket's Oral Medicine. 10th ed, New Delhi: BC Decker; 2007. pp. 41-76.
  5. Freeman DL. Harrison's principles of internal medicine. JAMA. 2001; 286(8): 971-72.
  6. Astani A, Heidary NM, Schnitzler P. Attachment and penetration of acyclovir resistant herpes simplex virus are inhibited by melissa officinalis extract. Phytother Res. 2014; 28(10): 1547-552.
  7. Schnitzler P, Nolkemper S, Stintzing FC, Reichling J. Comparative in vitro study on the anti-herpetic effect of phytochemically characterized aqueous and ethanolic extracts of Salvia officinalis grown at two different locations. Phytomedicine 2008; 15(1-2): 62-70.
  8. Kukhanova MK, Korovina AN, Kochetkov SN. Human herpes simplex virus: lifecycle and development of inhibitors. Biochem. 2014; 79(13): 1635-652.
  9. De Jalon EG, Blanco-Prieto MJ, Yqartua P, Santoyo S. Increased efficacy of acyclovir-loaded microparticles against herpes simplex virus type 1 in cell culture. Eur J Pharm Biopharm. 2003; 56(2): 183-87.
  10. Corey L, Adams H, Brown A, Holmes K. Genital herpes simplex virus infections, clinical manifestation, course and complications. Ann Intern Med. 2005; 98(6): 958-72.
  11. Arduino PG, Porter SR. Herpes simplex virus type 1 infection: overview on relevant clinic-pathological features. J Oral Pathol Med. 2008; 37(2): 107-21.
  12. Pastorino B, Baronti C, Gould EA, Charrel RN, Lamballerie X. Effect of chemical stabilizers on the thermostability and infectivity of a representative panel of freeze dried viruses. PloS one. 2015; 10(4): e0118963.
  13. Gilbert C, Bestman SJ, Boivin G. Resistance of herpes viruses to antiviral drug: clinical impacts and molecular mechanisms. Drug Resistance Updates 2002; 5(2): 88-90.
  14. Bacon TH, Levin MJ, Leary JJ, Sarisky RT, Sutton D. Herpes simplex virus resistance to acyclovir and penciclovir after two decades of antiviral therapy, Clinical microbiology reviews. 2003; 16(1): 114-28.
  15. Pilau MRAlves SHWeiblen RArenhart SCueto APLovato LT. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses. Braz J Microbiol. 2011. 42(4): 1616-624.
  16. Astani A, Schnitzler P. Antiviral activity of monoterpenes beta-pinene and limonene against herpes simplex virus in vitro. Iran J Microbiol. 2014; 3(6): 150-55.
  17. Cheng HY, Lin TC, Yang CM, Wang KC, Lin LT, Lin CC. Putranjivain A from Euphorbia jolkini inhibits both virus entry and late stage replication of herpes simplex virus type 2 in vitro. J Antimicrob Chemother. 2004; 53(4): 577-83.
  18. Gescher K, Hensel A, Hafezi W, Derksen A, Kühn J. Oligomeric proanthocyanidins from Rumex acetosa L. inhibit the attachment of herpes simplex virus type-1. Antiviral Res. 2011; 89(1): 9-18.
  19.  Astani A, Reichling J, Schnitzler P. Melissa officinalis extract inhibits attachment of herpes simplex virus in vitro. Chemother. 2012; 58(1): 70-77.
  20. Yangfei X, Ying P, Chang Q, Zhicai L, Zhe R, Ke Y, et al. In vitro anti herpes simplex virus activity of 1,2,4,6 Tetra O galloyl - β - D glucose from Phyllanthus emblica L. Euphorbiaceae. 2011; 25(7): 975-82.
  21.  Khanavi M, Norouzi M, Tabatabaee H, Noudeh A, Safavi S, Shafiee A. Chemical compositions and antiviral effects of the essential oil of zataria multiflora boiss and origanum majorana L. JMP. 2010; 1(33):128-37.
  22.  Cinatl J, Morgenstern G, Bauer G, Chndra P, Rabenau H, Doerr W. Glycyrrhizin, an active component of liquorice roots, and replication of SAR-associatde coronavirus. Lancet 2003; 361: 2045-2046.
  23.  Mardani M, Motamedifar M, Hoseinipour R. A study of the antiviral effect of the essential oil of zataria multiflora boiss on herpes simplex Type 1 in vero cell culture. J Dent Shiraz Univ Med Sci. 2012; 13: s414-s420.
  24. Farahani M. Antiviral effect assay of thymus kotschyanus and nerium oleander on HSV-1 in vitro. JSSU. 2013; 21(2): 189-97.
  25. Sabouri Ghanad AM, Safiallahy S, Faradmal J. The evaluation of methanolic extract of glycyrrhiza glabra effect on the replication of herpes simplex virus Type 1 in vero cell line. Avicenna Journal of Clinical Medicine 2014; 20(4): 325-32.
  26. Monavari SHR, Shamsi Shahrabadi M, Mortazkar P. the study of antiviral effects of glycyrrihza glabra extract on HSV. J Med Plants. 2008; 4(28): 81-86.
  27. Magi G, Marini E., Facinelli B. Antimicrobial activity of essential oils and carvacrol, and synergy of carvacrol and erythromycin, against clinical, erythromycin-resistant group A streptococci. Front Microbiol. 2015; 6: 165.
  28. Amoros M, Simoes CMO, Girre L, Sauvager F, Cormier M. Synergistic effect of flavones and flavonols against herpes simplex virus type 1 in cell culture. Comparison with the antiviral activity of propolis. J Nat Prod. 1992; 55: 1732-740.
  29. Astani A, Reichling J, Schnitzler P. Comparative study on the antiviral activity of selected monoterpenes derived from essential oils. Phytother Res. 2010; 24(5): 673-79.
Type of Study: Research | Subject: Virology
Received: 2017/08/30 | Accepted: 2018/04/3 | Published: 2018/05/15

Add your comments about this article : Your username or Email:
CAPTCHA

Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | International Journal of Medical Laboratory

Designed & Developed by : Yektaweb