Volume 5, Issue 4 (November 2018)                   IJML 2018, 5(4): 278-287 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Nourbakhsh F, Tajbakhsh E, Daneshmand D, Borooni S, Nourbakhsh V. Antibiotic Resistance Patterns and Molecular Typing of Acinetobacter Baumannii Strains Isolated from Burn Patients in Iran. IJML 2018; 5 (4) :278-287
URL: http://ijml.ssu.ac.ir/article-1-220-en.html
Department of Pharmacodynamics and Toxicology, Faculty of Pharmacy, Mashhad University of Medical Sciences, Mashhad, Iran.
Full-Text [PDF 682 kb]   (1172 Downloads)     |   Abstract (HTML)  (2905 Views)
Full-Text:   (1365 Views)
Introduction
Acinetobacter baumannii (A. baumannii) is a serious opportunistic and multidrug-resistant (MDR) pathogen that is responsible for nosocomial infections and frequently causes bacteremia and ventilator-related pneumonia in intensive care units (ICU) and health facilities [1, 2]. A. baumannii is a coccobacillus gram-negative bacterium, aerobic and non-fermented that belongs to the Moraxellaceae family. These species have a high prevalence in both community and hospital, especially among patients in ICU as well as high risk patients [3]. A. baumannii can be isolated from numerous sources such as soil, water, animals, and humans [4, 5]. Moreover, it has been implicated in different nosocomial infections, including endocarditis, meningitis, wounds, blood and infections of the skin, soft tissues, urinary tract, and those originating from other hospital environments [6].
The treatment of A. baumannii is difficult as it can be resistant to multiple classes of antimicrobials [7]. A. baumannii is naturally resistant to some antibiotics such as cephalosporin’s. However, it has a great capacity to develop resistance against many antibiotics, including carbapenems, aminoglycosides, and fluoroquinolones [8]. The resistance is acquired through the transfer of mobile genetic elements like Integrons, plasmids or transposons which carry groups of genes encoding resistance to various antibiotic families [9]. A. baumannii can produce carbapenemases, as the principle mechanism is of responsiblity for carbapenem resistance. This resistance is dramatically being observed worldwide mediated by carbapenems-hydrolyzing β-lactamases, belonging to 3 classes; class A, class B (metallo-β-lactamases), and class D (oxacillinases) [10-12]. Antimicrobial resistance is aquired from enzymatic degradation, modification of targets, or bacterium in hospital environments that are responsible for epidemics of A. baumannii in hospital-acquired species [13]. Today there are global distributions of MDR in clinical isolates all over the world. In the clinical laboratory, A. baumannii, together with three other species (Acinetobacter genomic species 13TU, Acinetobacter genomic species 3 and A. calcoaceticus), comprise the A. calcoaceticus, A. baumannii complex. They show a similarphenotype and are difficult to distinguish. [14].
The increase of carbapenems and β-lactamases resistance in A. baumannii motivated us to study genotypic and phenotypic resistance pattern in detected specimens isolated from patients hospitalized in different wards. This study helps us to clarify different mode of A. baumannii antibiotic-resistance determinants in A. baumannii strains isolated from burn patients in Iran. This cross-sectional study was conducted to elucidate the antibiotic resistance in A. baumannii detected from hospitalized patients in Isfahan, a province of Iran. The aim of this study was to determine the resistance profiles and prevalence of β-lactamase genes in MDR A. baumannii clinical isolates by applying Multiplex-polymerase chain reaction (M-PCR) assays.
Materials and Methods
Bacterial isolates
The primary culture showed polymicrobial growth in 65.2% of the detected samples. The most frequently isolated pathogens were Staphylococcus aureus (n=45), Acinetobacter species (n=132), true fungi (n=27), Staphylococcus epidermidis (n=41), and Pseudomonas aeruginosa (n=62). Afterwards, 132 samples of Acinetobacter were collected from different burnt patients in internal section their of which distributions are shown in figure 1. 100 samples of isolate were identified as A. baumannii, 20 samples were Acinetobacter Lwoffii and 12 samples as other Acinetobacter species. All 100 isolates of A. baumannii were collected from individuals suffering from different types of burn in Imam Musa Kazem burn center hospital in Isfahan. A. baumannii was detected in sample wounds collected from patients hospitalized in internal section. All the detected samples were directly cultured in 7% sheep blood agar (Merck, Darmstadt, Germany) and then incubated aerobically at 37°C for 48 h. After incubation, suspicious colonies were examined by using laboratory techniques appropriate for diagnosing A. baumannii species. These isolates were characterized and confirmed in the laboratories of the corresponding hospitals through routine microbiological and biochemical tests such as IMVIC, urease, triple sugar iron (TSI), OF, methyl Red–Voges-Proskauer (MRVP), sulfide-indole-motility (SIM), catalase, oxidase, and growth at 37°C and 42°C. The confirmed samples were stored at 30% glycerol at -70°C. The standard strains of Escherichia coli ATCC 25922 and A. baumannii ATCC 19606 were used as negative and positive controls (15-17). This cross-sectional study was in line with similar studies around the world during 2017.
 
 

Antibiotic profiles
A. baumannii isolates was selected and the antibiotic resistance pattern was performed by a disk diffusion method on Mueller–Hinton agar. A. baumannii isolates were tested for sensitivity to tetracycline (30 µg), ceftazidime (30 µg), ciprofloxacin (30 µg), cotrimoxazole (25 µg), tobramycin (10 µg), chloramphenicol (30 µg), Norfloxacin (10 µg), amikacin (30 µg), gentamycin (10 µg), rifampin (5 µg), cefalotin (30 µg), streptomycin (10 µg), trimethoprim (5 µg), levofloxacin (5 µg), imipenem (10 µg), meropenem (10 µg), nitrofurantoin (300 µg), azithromycin (15 µg), and erythromycin (15 µg), by the Kirby-Bauer disk diffusion method. MAST, Merseyside, England was used related to Clinical and Laboratory Standards Institute (CLSI), 2011. A. baumannii ATCC 19606 was used as the positive control strain [18-20].
DNA extraction of A. baumannii isolates
Stock cultures were maintained in both agar slant and 20% sterile buffered glycerin and were kept at -70°C. Genomic DNA was extracted from the bacterial isolates using the genomic DNA purification Kit (Merck, Germany) method, according to Kit protocol.
Detection of genes coding for virulence factors byusing M-PCR assays
Detection of the main groups of genes which are effective in A. baumannii resistance was performed by using M-PCR. The used primers are shown in Table 1. Amplification reaction was performed in a final volume of 50 μl. Each reaction mixture contained 5 μl of 10X PCR buffer; 1.6 IU of Taq DNA polymerase, and 2 μl of mixed deoxy ribonucleotide triphosphates, 2 mmol/L MgCl2, 500 ng of primer and 10 ng of bacterial DNA. The conditions used for PCR were 94°C for 5 min, followed by 30 cycle of denaturation at 94°C for 25 seconds, annealing at 53°C for 40 seconds, extension at 72°C for 50 seconds and final extension at 72°C for 6 min. PCR products were separated by electrophoresis on a 1% agarose gel. Also 50 μl of M-PCR products were loaded on a 1% agarose gel containing 0.5 mg/ml of ethidium bromide in Tris-borate-EDTA buffer at 90 V for 1 h. Finally, the products were examined with ultraviolet illumination [21]. The Ethics Committee of Mashhad university of Medical Sciences, Mashhad, Iran approved this research.
Statistical Analysis
The data were analyzed by Chi-square, Fischer’s test and SPSS statistical software version 16.
 
Table 1. Primers of polymerase chain reaction
Primers Nucleotide sequences (5¢→ 3¢) Amplicon size (bp)
16S-23S ribosomal DNA (F) CATTATCACGGTAATTAGTG
(R) AGAGCACTGTGCACTTAAG
208
aadA1 (F) TATCCAGCTAAGCGCGAACT
(R) ATTTGCCGACTACCTTGGTC
447
aac(3)-IV (F) CTTCAGGATGGCAAGTTGGT
(R) TCATCTCGTTCTCCGCTCAT
286
sul1 (F) TTCGGCATTCTGAATCTCAC
(R) ATGATCTAACCCTCGGTCTC
822
blaSHV (F) TCGCCTGTGTATTATCTCCC
(R) CGCAGATAAATCACCACAATG
768
CITM (F) TGGCCAGAACTGACAGGCAAA
(R) TTTCTCCTGAACGTGGCTGGC
462
cat1 (F) AGTTGCTCAATGTACCTATAACC
(R) TTGTAATTCATTAAGCATTCTGCC
547
cmlA (F) CCGCCACGGTGTTGTTGTTATC
(R) CACCTTGCCTGCCCATCATTAG
698
tet(A) (F) GGTTCACTCGAACGACGTCA
(R) CTGTCCGACAAGTTGCATGA
577
tet(B) (F) CCTCAGCTTCTCAACGCGTG
(R) GCACCTTGCTGATGACTCTT
634
dfrA1 (F) GGAGTGCCAAAGGTGAACAGC
(R)GAGGCGAAGTCTTGGGTAAAAAC
367
Qnr (F) GGGTATGGATATTATTGATAAAG
(R) CTAATCCGGCAGCACTATTTA
670
Imp (F) GAATAGAATGGTTAACTCTC
(R) CCAAACCACTAGGTTATC
188
Vim (F) GTTTGGTCGCATATCGCAAC
(R) AATGCGCAGCACCAGGATAG
382
Sim (F) GTACAAGGGATTCGGCATCG
(R) GTACAAGGGATTCGGCATCG
569
Oxa-51-like (F) TAATGCTTTGATCGGCCTTG
(R) TGGATTGCACTTCATCTTGG
353
Oxa-23-like (F) GATCGGATTGGAGAACCAGA
(R) ATTTCTGACCGCATTTCCAT
501
Oxa-24-like (F) GGTTAGTTGGCCCCCTTAAA
(R) AGTTGAGCGAAAAGGGGATT
246
Oxa-58-like (F) AAGTATTGGGGCTTGTGCTG
(R) CCCCTCTGCGCTCTACATAC
599
 
Results
A. baumannii antibiotic susceptibility tests
Among the detected A. baumannii strains, all samples (100%) were MDR. On the basis of antibiotic resistance pattern, it was mentioned that approximately 82.5% of samples were resistant to ciprofloxacin, 75.3% to ceftazidime and 72% to tetracycline. In addition, none of the resistant strains was showed complete resistance to all antibiotics. Other antimicrobial resistance profiles of A. baumannii are shown in figure 2. Antibiotic susceptibility pattern of A. baumannii is shown in Table 2.
The result of M-PCR in A.baumannii
Molecular typing of genes related to A. baumannii antibiotic resistance pattern shows the frequency of genes (Fig. 3). CITM (91.1%) was the highest detected genes. The frequency of the other genes were qnr (91.3%), imp (80.2%), tet(B) (76.2%), Oxa-58-like (73.4%), sul1 (67.3%), sim (62.9%), dfrA1 (62%), Oxa-51-like (61.5%), Oxa-24-like (61.2%), Oxa-23-like (53.5%), blaSHV (51.2%), tet(A) (43.1%), vim (33.3%), aadA1 (25.6%), cmlA (18%), cat1 (6.8%). A. baumannii isolates detected from different burnt patients showed that the most frequent age range of the patients was between 61-70 (60.2%) who were hospitalized in different wards of the hospitals. Also, 59% of patients were women in this study.
 
Table 2. Antibiotic susceptibility pattern of A.baumannii
  Resistance Intermediate Sensitive
Ciprofloxacin 97.2 2.8 0
Ceftazidime 88.3 6.5 5.2
Tetracycline 86.2 10.2 3.6
Trimethoprim 74 12.6 13.4
Norfloxacin 73.2 15 11.8
Gentamicin 69.6 22 8.4
Azithromycin 69 14 17
Meropenem 67.2 20.2 12.6
Erythromycin 64.8 32.9 2.3
Sulfamethoxazole trimethoprim 59 26.1 14.9
Tobramycin 58.2 21.2 20.6
Cephalothin 57.2 30.9 11.9
Levofloxacin 56.2 23.8 20
Amikacin 47.2 33 19.8
Rifampin 46.1 36.2 17.7
Imipenem 44 36.2 19.8
Streptomycin 35.2 9.5 55.3
Chloramphenicol 3.9 7.2 88.9
Nitrofurantoin 2.8 9.2 88
Data are presented as percent
 
 
 



Discussion
Different species of Acinetobacter have either a strong tendency to become resistant to antibiotics or inherently resistant to some broad antibiotics. On the basis of, they have a great ability to gain new mechanisms of resistance [22, 23]. According to the spread of antibiotic resistance in A.baumannii, and since burn part of Isfahan had not conducted a comprehensive study on antibiotic resistance pattern and gene expression of these bacteria, this study was carried out to show frequency of genetic pattern in antibiotic resistance isolated in burn hospital in Isfahan. The majority of isolates examined in this study were MDR. The highest rate of drug resistance related to tetracycline (72%), ciprofloxacin (82.5%), and ceftazidime (75.3%). In line with our research, some studies have been conducted in different part of hospitals in Iran. In a similar study, Momtaz et al. observed almost the same pattern that A. baumannii are resistance to tetracycline (90.9%), trimethoprim (61.9%), cotrimoxazole (51.2%) and aminoglycoside compounds in a range between 9.9-31.4% [24].
In a study performed by Shakibaii et al. on 50 samples of A. baumannii isolates selected from the ICU in Kerman hospitals, the antibiotic-resistant pattern showed that the percentage of resistance to imipenem, ciprofloxacin, piperacillin-tazobactam, amikacin, cefepime and piperacillin have been 73.3%, 66%, 93.3%, 53.3%, 93.3%, and 100%, respectively [25].
In another study, the result of antibiotic resistance pattern of A. baumannii isolated from patients was partially different from the results of ours. It was shown the resistance rate of 94% to kanamycin, 86% to gentamicin, 81% to amikacin and 63% to tobramycin. Different antibiotic resistance in various studies can be related to clinical sample types or geographic region of the test [26].
The distribution of genes encoding resistance to antibiotics was one of the important goals of our study. The presence of these genes was shown in these 100 isolates. Compared with this study, the distribution of β-lactamase genes was reported in 21 nosocomial outbreak isolates of A. baumannii in a Chinese hospital. In this study, all of the isolates contain blaOXA-51-Like and just eight strains contains blaOXA-23-Like gene [27]. Another study identified that the isolates were resistant to imipenem (93.8%), and contained blaOXA-23-Like (71.1%), and blaOXA-58-Like genes (22.8%). Compared with our study, they did not detect Oxa-24-like, Oxa-51-like, vim, sim and imp in their isolates [28]. Unlike these results, Mirnejad et al. demonstrated that 82% of A. baumannii carried integrons Class II. There was a significant correlation between integrons and antibiotics resistance pattern to cefepime, aztreonam, amikacin, ciprofloxacin, norfloxacin, ofloxacin and ceftazidime [29].
Conclusion
The results of this cross-sectional study were in agreement with similar studies around the world. Due to increased drug resistance, wider research and further studies are necessary to control hospital infections.
Conflict of Interest
The authors declare no conflict of interest.
Acknowledgment
The authors thank Hospital staff for providing the reference strains.
 
References
  1.  Lowings M, Ehlers MM, Dreyer AW, Kock MM. High prevalence of oxacillinases in clinical multidrug-resistant Acinetobacter baumannii isolates from the Tshwane region, South Africa - an update. BMC Infect Dis. 2015;15:521.
  2.  Mathlouthi N, Ben Lamine Y, Somai R, Bouhalila-Besbes S, Bakour S, Rolain JM, et al. Incidence of OXA-23 and OXA-58 carbapenemases coexpressed in clinical isolates of acinetobacter baumannii in Tunisia. Microb Drug Resist. 2018;24(2):136-41.
  3. Japoni S, Japoni A, Farshad S, Ali AA, Jamalidoust M. Association between existence of integrons and multi-drug resistance in Acinetobacter isolated from patients in southern Iran. Pol J Microbiol. 2011; 60(2): 163-68.
  4.  Azhari F, Farajnia S, Rahnema M. Investigation of prevalence of esbl types veb-1 and per-2 genes and int-1 in acinetobacter bumanii strains isolated from patients of Imam Reza hospital in Tabriz. Q J Biol Sci. 2010; 4(11): 1-10.
  5.  Kheltabadi RF, Moniri R, Shajari GR, Shirazi MHN, Musavi SGA, Ghasemi A, et al. Antimicrobial susceptibility patterns and the distribution of resistance genes among Acinetobacter species isolated from patients in shahid Beheshti hospital, Kashan. Feyz J Kashan Uni Med Sci. 2009; 12(4): 61-7.
  6.  Peymani A, Higgins PG, Nahaei MR, Farajnia S, Seifert H. Characterisation and clonal dissemination of OXA-23-producing Acinetobacter baumannii in Tabriz, northwest Iran. Int J Antimicrob Agents 2012; 39(6): 526-28.
  7. Biglari S, Hanafiah A, Mohd Puzi S, Ramli R, Rahman M, Lopes BS. Antimicrobial resistance mechanisms and genetic diversity of multidrug-resistant acinetobacter baumannii isolated from a teaching hospital in Malaysia. Microb Drug Resist. 2017; 23(5): 545-55.
  8.  Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2007; 5(12): 939-51.
  9.  Fournier PE, Vallenet D, Barbe V, Audic S, Ogata H, Poirel L, et al. Comparative genomics of multidrug resistance in acinetobacter baumannii. PLoS Genet. 2006; 2(1): e7.
  10.  Azizi O, Shakibaie MR, Modarresi F, Shahcheraghi F. Molecular detection of class-D OXA carbapenemase genes in biofilm and non-biofilm forming clinical isolates of acinetobacter baumannii. Jundishapur J Microbiol. 2015;8(1): e21042.
  11.  Karah N, Sundsfjord A, Towner K, Samuelsen O. Insights into the global molecular epidemiology of carbapenem non-susceptible clones of Acinetobacter baumannii. Drug Resist Updat. 2012; 15(4): 237-47.
  12.  Safari M, Saidijam M, Bahador A, Jafari R, Alikhani MY. High prevalence of multidrug resistance and metallo-beta-lactamase (MβL) producing Acinetobacter baumannii isolated from patients in ICU wards, Hamadan, Iran. J Res Health Sci. 2013; 13(2): 162-67.
  13.  Manchanda V, Sanchaita S, Singh N. Multidrug resistant acinetobacter. J Glob Infect Dis. 2010; 2(3): 291-304.
  14.  Stokes HW, Gillings MR. Gene flow, mobile genetic elements and the recruitment of antibiotic resistance genes into Gram-negative pathogens. FEMS Microbiol Rev. 2011; 35(5): 790-819.
  15.  Koeleman JG, Stoof J, Van Der Bijl MW, Vandenbroucke-Grauls CM, Savelkoul PH. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J Clin Microbiol. 2001; 39(1): 8-13.
  16.  Ploy MC, Denis F, Courvalin P, Lambert T. Molecular characterization of integrons in Acinetobacter baumannii: description of a hybrid class 2 integron. Antimicrob Agents Chemother. 2000; 44(10): 2684-688.
  17.   Woodford N, Ellington MJ, Coelho JM, Turton JF, Ward ME, Brown S, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006; 27(4): 351-53.
  18.  Institute CaLS. Performance standards for antimicrobial disk susceptibility testing; 15th informational supplement, CLSI/NCCLS M100-S25. Wayne, Pa: Clinical and Laboratory Standards Institute; 2015.
  19.  Mendes RE, Kiyota KA, Monteiro J, Castanheira M, Andrade SS, Gales AC, et al. Rapid detection and identification of metallo-beta-lactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. J Clin Microbiol. 2007; 45(2): 544-47.
  20.  Randall LP, Cooles SW, Osborn MK, Piddock LJ, Woodward MJ. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J Antimicrob Chemother 2004; 53(2): 208-16.
  21.  Hujer KM, Hujer AM, Hulten EA, Bajaksouzian S, Adams JM, Donskey CJ, et al. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother. 2006; 50(12): 4114-123.
  22.  Irfan S, Turton JF, Mehraj J, Siddiqui SZ, Haider S, Zafar A, et al. Molecular and epidemiological characterisation of clinical isolates of carbapenem-resistant Acinetobacter baumannii from public and private sector intensive care units in Karachi, Pakistan. J Hosp Infect. 2011; 78(2): 143-48.
  23.  Xu Z, Li L, Shirtliff ME, Alam MJ, Yamasaki S, Shi L. Occurrence and characteristics of class 1 and 2 integrons in Pseudomonas aeruginosa isolates from patients in southern China. J Clin Microbiol. 2009; 47(1): 230-34.
  24.  Momtaz H, Khamesipour F, Tavakol M, Awosile B. Determination of antimicrobial resistance and resistant genes in acinetobacter baumannii from human clinical samples. West India Med J. 2015; 66(1).
  25.  Shakibaie MR, Adeli S, Salehi MH. Antibiotic resistance patterns and extended-spectrum β-lactamase production among Acinetobacter spp. isolated from an intensive care Unit of a hospital in Kerman, Iran. Antimicrob Resist Infec Control. 2012; 1(1): 1.
  26.  Aliakbarzade K, Farajnia S, Karimi Nik A, Zarei F, Tanomand A. Prevalence of aminoglycoside resistance genes in acinetobacter baumannii Isolates. Jundishapur J Microbiol. 2014; 7(10): e11924.
  27.  Huang L, Sun L, Xu G, Xia T. Differential susceptibility to carbapenems due to the AdeABC efflux pump among nosocomial outbreak isolates of Acinetobacter baumannii in a Chinese hospital. Diagn Microbiol Infect Dis. 2008; 62(3): 326-32.
  28.  D'Arezzo S, Principe L, Capone A, Petrosillo N, Petrucca A, Visca P. Changing carbapenemase gene pattern in an epidemic multidrug-resistant Acinetobacter baumannii lineage causing multiple outbreaks in central Italy. J Antimicrob Chemother. 2011; 66(1): 54-61.
  29.  Mirnejad R, Mostofi S, Masjedian F. Antibiotic resistance and carriage class 1 and 2 integrons in clinical isolates of Acinetobacter baumannii from Tehran, Iran. Asian Pacific J Tropic Biomed. 2013; 3(2): 140-45. 
Type of Study: Research | Subject: Bactriology
Received: 2018/02/25 | Accepted: 2018/10/8 | Published: 2018/11/15

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | International Journal of Medical Laboratory

Designed & Developed by : Yektaweb