Volume 7, Issue 2 (May 2020)                   IJML 2020, 7(2): 138-144 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Nourbakhsh F, Nourbakhsh V, Borooni S, Tajbakhsh E, Daneshmand D. Molecular Investigation of Staphylococcal Cassette Chromosome mec (SCCmec) Elements Isolated from Intensive Care Unit. IJML 2020; 7 (2) :138-144
URL: http://ijml.ssu.ac.ir/article-1-336-en.html
Departments of Microbiology, Faculty of Basic Sciences, Shahrekord Branch, Islamic Azad University, Shahrekord, Iran.
Full-Text [PDF 354 kb]   (783 Downloads)     |   Abstract (HTML)  (2037 Views)
Full-Text:   (991 Views)
Introduction
Research on bacterial resistance has a long tradition, especially antibiotic resistance pattern in Staphylococcus aureus (S. aureus) as an important pathogen which can colonize in the community and hospital surfaces or organs [1]. There are several common kinds of infections as reported by S. aureus including various soft-tissue, systemic, and endocarditic infections as well as urinary tract infections (UTIs) [2]. Due to the widespread prevalence of infections caused by S. aureus and also resistance to methicillin, genetic background and the SCC mec typing have become especially important [3, 4].
It has been indicated that methicillin or aminoglycosides are antibiotics their resistance patterns of which quickly increases [5]. Methicillin resistance S. aureus (MRSA) is mediated by mecA gene and staphylococcal cassette chromosome mec (SCCmec) as a mobile genetic element (size: 21-67 kbp).
As it is indicated, SCCmec are classified into 8 different types (I–VIII). The literature review reveals that SCC mec type I was specified in 1961 in UK, type II in Japan, and types III, IV and V were distinctive in New Zealand. Several studies related to SCCmec elements have demonstrated that hospital acquired-MRSA (HA-MRSA) are detected in type III of SCCmec but community acquired-MRSA (CA-MRSA) are susceptible to various widespread antibiotics [6, 7].
Previous studies have emphasized the presence of a wide pattern of resistance to other various therapeutic options such as β-lactamase, macrolides, lincosamides, and mupirocin [7]. Several studies have reported about msrA and msrB (related to macrolides), ermA, ermB and ermC (related to macrolide, lincosamide, streptogramin B), mecA (related to methicillin), ant (4´)-Ia, aac (6´)- Ie/aph(2˝), and aph(3´)-IIIa (related to aminoglycosides modifying enzymes), mupA (related to mupirocin) and tet (related to tetracycline) [8]. Concerning the prevalence of drug resistance, MRSA infections have increased the number of related reviews. Hence, we decided to investigate antimicrobial resistance pattern of mecA gene and SCCmec phenotypes recovered from the intensive care unit (ICU) in Isfahan, Iran [9, 10].
Materials and Methods
Bacterial isolates
Overall, 76 clinical strains were collected from various samples such as wound (n= 31; 40.8%), blood (n= 5; 6.6%), ear (n= 2; 2.6%), pus (n= 8; 10.5%), body catheter (n= 16; 21%), and urine (n=14; 18.5%) out of hospitalized patients in the ICUs. Furthermore, patient's samples were immediately transported to the laboratory for performing additional tests. All the samples were directly cultured into 7% sheep blood agar (Merck, Darmstadt, Germany) and distinguished by the conventional microbiological methods [11). Further, molecular studies have been performed for drug resistance studies [12].
Antibiotic susceptibility testing
Susceptibility to penicillin (10 u/disk), imipenem (10 μg/disk), cefazolin (30 μg/disk), cefalotin (30 μg/disk), ceftriaxone (30 μg/disk), gentamicin (10 μg/disk), ciprofloxacin (5 μg/disk), clindamycin (2 μg/disk), azithromycin (15 μg/disk), erythromycin (15 μg/disk), mupirocin (30 μg/disk), rifampicin (5 μg/disk), tetracycline (30 μg/disk), trimethoprim (5 μg/disk), vancomycin (30 μg/disk), nitrofurantoin (300 μg/disk), and methicillin (30 μg/disk) was determined using the Kirby-Bauer disk diffusion technique in accordance with the clinical and laboratory standards institute (CLSI) [11, 13].
DNA extraction and genes amplification
A typical colony of the biochemically identified S. aureus was cultivated in 1 mL tryptic soy broth (TSB) for 24 h at 37˚C. The bacterial genomic DNA of S. aureus strains were extracted with a QIAGEN plasmid Minikit (Fermentas, Germany) as recommended. The presence of mecA, tetK, tetM, ermA, ermC, aacA-D, linA, msrA, vatA, vatC and vatB genes was identified using the Kumar technique [2, 13]. A polymerase chain reaction (PCR) primer for amplification of antibiotic resistance genes in S. aureus strains and SCCmec typing was selected by references [4, 6].
Multiplex PCR amplification for SCCmec typing
Different SCCmec types determined by specific primers, are listed in table 1. PCR amplification was performed in a volume of 50 ml with Emerald Amp MAX PCR Master Mix (Takara, Japan) for all PCR reactions [14]. The DNA Thermal Cycler 480 (Applied Bio systems, Foster City, CA, USA) was programmed as follows: the first denaturation at 94 8C for 5 min, denaturation at 94 8C for 30 s, annealing at 55 8C for 30 s, and an extension at 72 8C for 60 s for 40 cycles and at last the final extension at 72 8C for 4 min. PCR products were analyzed by electrophoresis on agarose 1.5% with SYBR safe staining according to kit protocol [15, 16].
Results
According to the results, 53 (69.7%) out of 76 clinical samples were methicillin resistance. Furthermore, 39 (63.51%) of MRSA samples were PVL positive (51.3%). It was shown that there are significant differences between the types of infections and incidence of MRSA (p=0.049).

Table 1. Oligonucleotide primers for amplification of SCCmec types in Staphylococcus aureus strains isolated from Isfahan hospitals
Types Primer Sequence (5’-3’) Size of product (bp)
SCCmec I F:GCTTTAAAGAGTGTCGTTACAGG
R: GTTCTCTCATAGTATGACGTCC
613
SCCmec II F: CGTTGAAGATGATGAAGCG
R: CGAAATCAATGGTTAATGGACC
398
SCCmec III F: CCATATTGTGTACGATGCG
R: CCTTAGTTGTCGTAACAGATCG
280
SCCmec Iva F: GCCTTATTCGAAGAAACCG
R: CTACTCTTCTGAAAAGCGTCG
776
SCCmec IVb F: TCTGGAATTACTTCAGCTGC
R: AAACAATATTGCTCTCCCTC
493
SCCmec IVc F:ACAATATTTGTATTATCGGAGAGC
R: TTGGTATGAGGTATTGCTGG
200
SCCmec IVd F: CTCAAAATACGGACCCCAATACA
R: TGCTCCAGTAATTGCTAAAG
881
SCCmec V F: GAACATTGTTACTTAAATGAGCG
R: TGAAAGTTGTACCCTTGACACC
325
Antibiotic susceptibility pattern showed the highest level of resistance against methicillin (98%), penicillin (97.24%), tetracycline (89.64%). Molecular detection of antibiotic resistance genes showed the frequency of mecA (89.61%), tetK (88.23%), tetM (49.15%) and msrA (46.93%). It was also revealed that, SCCmec types III (16.82%) and II (14.53%) are the most commonly detected SCCmec types. There was significant dif­ference in incidence percentage and number of types of infections (p=0.029). Significant difference was also reported as for antibiotic resistance genes compared with the type of infection (p=0.035). Antibiotic susceptibility pattern in various types of clinical infections is shown in table 2.
According to the results, mecA (89.61%) and tetK (88.23%) were the most commonly-detected antibiotic resistance genes the lowest patterns of which were related to vatC (1.2%) and vatB (1%) genes. Other antibiotic resistance genes showed frequency with msrA (46.93%), aacA-D (18.82%), tet M (50.17%), ermA (29.20%), ermC (29.20%), vatA (1.7%), linA (9.48%). Recognition procedures of SCCmec typing are shown in table 3. It was also identified that the most commonly detected SCCmec types in the MRSA strains are types II and III.
 
Table 2. Antibiotic susceptibility pattern in various types of clinical infections
Types of Infection % Antimicrobial agents
Total% Catheter Ear Pus  Urine Blood Wound
97.24 3.44 3 10 12 20. 1 48.7 Penicillin
42.5 10 5.5 2 1 3 21 Imipenem
52 10.9 5 7 8.1 9 12 Cefazolin
58.7 2.6 4 8 8.7 12.3 23.1 Cefalotin
65.4 5.6 1 2 20.1 4.6 32.1 Ceftriaxone
72.1 4.1 2.1 3 8.4 12 42.5 Gentamicin
87.3 10 3.2 8.1 10.2 21 34.8 Ciprofloxacin
21 2 0 1 8.2 2.8 7 Clindamycin
53 2.2 8 9.2 6.3 7 20.3 Azithromycin
83.4 4 1.1 7.3 9 21 41 Erythromycin
18.2 3.2 2 1 3 2 7 Mupirocin
19.3 2 1 7 2 2.3 3 Rifampicin
89.64 7.84 2 3 13 23 40.8 Tetracycline
22 4 2 7 3 1 5 Trimethoprim
98 3 1 10 21 3 60 Methicillin
1 0 0 0 0 0 1 Vancomycin
5 0 0 0 3 1 1 Nitrofurantoin
 
Table 3. Frequency and recognition procedures of SCCmec typing
Type V Type VdI Type VcI Type VbI Type VaI TypeIII TypeII TypeI Number Infection
- 1 1 - - 15 3 1 21 Wound
- - - - - 8 7 2 5 Blood
- 1 - - 1 11 10 2 11 Urine
2 - - - - - 1 - 8 Pus
- - - - - - 1 - 2 Ear
- - - 1 - 1 - 1 5 Catheters
2 2 1 1 1 35 22 6 53 Total
 
 
 
Discussion
All clinical samples were obtained from Hazrat Fatemeh Zahra Hospital in Isfahan, and were evaluated by PCR methods. The MRSA screening was performed by genotypic and phenotypic methods; also antibiotic resistance pattern was determined by using the disk diffusion method and related genes by PCR. According to the results, in environmentally-infected hospitals, antibiotics are used at a highly irregular manner in ICUs. Similar studies with various results, all of which indicating high drug resistance, have been reported previously by different authors [17, 18]. Because of the lack of sampling limits and section specific conditions we decided not to investigate patient endotracheal tube specimens. Totally, 53 (69.7%) out of 76 clinical samples were positive for MRSA and also out of 76 MRSA strains, 39 (63.51%) were PVL positive.
These results indicate that refractory Staphylococcal diseases are highly prevalent and can threaten patients and even healthy individuals in hospitals. Staphylococcus strains of our investigation had the highest levels of antibiotic resistance against methicillin, erythromycin, ciprofloxacin and penicillin. The lowest resistance was identified for vancomycin and nitrofurantoin.
A similar conclusion was reached by Nourbakhsh and co-authors that showed the highest resistance belonging to methicillin, erythromycin, ciprofloxacin and penicillin and the lowest relating to vancomycin and nitrofurantoin [4]. They demonstrated that SCCmec III is the most type out of 103 mec positive strains. Results of both studies revealed significant relation between frequency of antibiotic resistance genes and the prevalence of mecA. We also distinguished statistically significant relationship between various types of isolated samples, the wound isolates and frequency of methicillin resistance S.aureus. Previous studies by Ebadi have emphasized 75.7% of detected samples being pertinent to MRSA in comparison with the present study by which the researchers identified 32.1% of samples as being positive for SCCmec type I [15].
Similar studies have been carried out by Udo showing 32% incidence rate of the MRSA strains thus revealing overuse of antibiotics in the group [19]. Molecular characterization, evolution, and epidemiology of S.aureus by Lakhundi in 2018 reports that new They reported an increase in S.aureus pollution as well as the transfer of pollution from the environment to the community clones of S.aureus [20]. Because of the importance of investigating drug resistance in S.aureus, studies have been conducted on new methods of diagnosis, investigation and web-based tool for typing staphylococcal infections [21].
A similar conclusion was drawn by Dhawan revealing that CA-MRSA (83%) is the most popular SCCmec genotype with frequency of SCCmec types  II[22] thus being similar to those of Alon D et al stating that type II SCCmec is the most predominant type of mec element [23]. In another research by Halaji et al, Panton-Valentine Leukocidin in Methicillin-Resistant S.epidermidis and SCCmec was examined in particular. In this research, it was identified that 12.70 (17%) of MRSE isolates carry PVL gene, thus being similar to our results with 51.3% PVL positive [24]. According to our results, SCCmec V and SCCmec became particularly significant. Similar results have been reported as to other species subtypes such as SCCmec V and SCCmec IVc, types Iva and types IVb. Similarly, D’Souza indicated that from 97 mecA-positives S.aureus, 25% were positive for SCCmec III and 34% for SCCmec IV. In addition, 73% of SCCmec IV were reported as  multidrug resistant (MDR) strains [25]. These results all indicate a high prevalence of drug resistance.
Conclusion
Our data revealed that mecA gene and resistance to methicillin (98%), penicillin (97.24%), tetracycline (89.64%) are the most commonly detected characteristics of the MRSA strains isolated from hospitals infections and also the SCCmec type III was predominant among ICU patients. The results of this study demonstrated that regular surveillance of hospital-associated infections and monitoring antibiotic sensitivity patterns are required. In summary, this paper argued that, special care is necessary to control drug resistance.
Conflict of Interest
The authors report no conflicts of interest.
Acknowledgments
We would like to express our gratitude to the basic sciences department of Islamic Azad University of Shahrekord, and medical staff in intensive care unit coordinator center of Isfahan for their cooperation.
 
References
  1. Nourbakhsh F, Namvar AE. Detection of genes involved in biofilm formation in Staphylococcus aureus isolates. GMS hygiene and infection control. 2016; 11: Doc. 7.
  2.  Nourbakhsh F, Momtaz H. Evaluation of phenotypic and genotypic biofilm formation in staphylococcus aureus isolates isolated from hospital infections in Shahrekord, 2015. Evaluation 2016; 19(109): 69-79.
  3.  Borooni S, Nourbakhsh V, Nourbakhsh F, Tajbakhsh E, Yazdanpanah A. Biofilm formation and its genes expressions in Staphylococcus epidermidis isolated from urinary tract infections of children in Isfahan. Int Archiv Health Sci. 2019; 6(1): 41.
  4.   Nourbakhsh F, Ebrahimzadeh Namvar A, Momtaz H. Characterization of staphylococcal cassette chromosome mec elements in biofilm-producing staphylococcus aureus, isolated from hospital infections in Isfahan. Int J Med Lab. 2016; 3(1): 33-42.
  5.   Boyle Vavra S, Ereshefsky B, Wang CC, Daum RS. Successful multiresistant community-associated methicillin-resistant Staphylococcus aureus lineage from Taipei, Taiwan, that carries either the novel staphylococcal chromosome cassette mec (SCCmec) type VT or SCCmec type IV. J Clinic Microbiol. 2005; 43(9): 4719-730.
  6.  Namvar AE, Afshar M, Asghari B, Lari AR. Characterisation of SCCmec elements in methicillin-resistant Staphylococcus aureus isolated from burn patients. Burns 2014; 40(4): 708-12.
  7.  Havaei SA, Namvar AE, Moghim S, Lari AR. Evaluation of various staphylococcal cassette chromosome mec (SCCmec) types in Staphylococcus epidermidis invasive strains from hospitalised patients in Iran. Infect Med. 2015; 23(1): 18-22.
  8.  Khan S, Nawaz M, Khan A, Cerniglia C. Simultaneous detection of erythromycin-resistant methylase genes ermA and ermC from Staphylococcus spp. by multiplex-PCR. Molecular and cellular probes 1999; 13(5): 381-87.
  9.  Liu J, Chen D, Peters BM, Li L, Li B, Xu Z, et al. Staphylococcal chromosomal cassettes mec (SCCmec): a mobile genetic element in methicillin-resistant Staphylococcus aureus. Microb Pathogen 2016; 101: 56-67.
  10.  Turlej A, Hryniewicz W, Empel J. Staphylococcal cassette chromosome mec (Sccmec) classification and typing methods: an overview. Pol J Microbiol. 2011; 60(2): 95-103.
  11.  Milheiriço C, Oliveira DC, de Lencastre H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus:‘SCC mec IV multiplex’. J Antimicrob Chemother. 2007; 60(1): 42-8.
  12.  Kearns A, Seiders P, Wheeler J, Freeman R, Steward M. Rapid detection of methicillin-resistant staphylococci by multiplex PCR. J Hospital Infect. 1999; 43(1): 33-7.
  13.  Kumar R, Yadav B, Singh R. Antibiotic resistance and pathogenicity factors in Staphylococcus aureus isolated from mastitic Sahiwal cattle. J Biosci. 2011; 36(1): 175-88.
  14.   Milheiriço C, Oliveira DC, de Lencastre H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents Chemotherapy 2007; 51(9): 3374-377.
  15.  Ebadi M, Ashrafi H. Typing of methicillin-resistant staphylococcus aureus isolate from healthcare workers in Larestan, Iran. Journal of Microbiol Infect Dis. 2018; 8(01): 1-7.
  16. Matouskova I, Janout V. Current knowledge of methicillin-resistant Staphylococcus aureus and community-associated methicillin-resistant Staphylococcus aureus. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 2008; 152(2): 191-202.
  17.  Amorim ML, Vasconcelos C, Oliveira DC, Azevedo A, Calado E, Faria NA, et al. Epidemiology of methicillin-resistant Staphylo-coccus aureus (MRSA) nasal colonization among patients and healthcare workers in a Portuguese hospital: a pre-intervention study toward the control of MRSA. Microb Drug Resist. 2009; 15(1): 19-26.
  18.   Havaei SA, Ghanbari F, Rastegari AA, Azimian A, Khademi F, Hosseini N, et al. Molecular typing of hospital-acquired Staphylococcus aureus isolated from Isfahan, Iran. International Scholarly Research Notices 2014; 11(9): 18527-8572.
  19.  Udo E, Al-Sweih N, Dhar R, Dimitrov T, Mokaddas E, Johny M, et al. Surveillance of antibacterial resistance in Staphylococcus aureus isolated in Kuwaiti hospitals. Med Principl Pract. 2008; 17(1): 71-5.
  20.  Lakhundi S, Zhang K. Methicillin-resistant Staphylococcus aureus: molecular characterization, evolution, and epidemiology. Clinic Microbiol Rev. 2018; 31(4): 20-28.
  21. Kaya H, Hasman H, Larsen J, Stegger M, Johannesen TB, Allesøe RL, et al. Sccmecfinder, a web-based tool for typing of Staphylococcal cassette chromosome Mec in Staphylococcus aureus using whole-genome sequence data. Msphere 2018; 3(1): 612-17.
  22.  Dhawan B, Rao C, Udo E, Gadepalli R, Vishnubhatla S, Kapil A. Dissemination of methicillin-resistant Staphylococcus aureus SCCmec type IV and SCCmec type V epidemic clones in a tertiary hospital: challenge to infection control. Epidemiol Infect. 2015; 143(2): 343-53.
  23.  Alon D, Abd-Elkadir F, Chowers M, Paitan Y. MRSA SCCmec epidemiology in Israel: development and implementation of an MRSA SCCmec typing strategy. Euro J Clinic Microbiol Infect Dis. 2011; 30(11): 1443.
  24.   Halaji M, Karimi A, Shoaei P, Nahaei M, Khorvash F, Ataei B, et al. Distribution of SCCmec elements and presence of Panton-Valentine Leukocidin in Methicillin-Resistant Staphylococcus epidermidis isolated from clinical samples in a University Hospital of Isfahan City, Iran. J Clinic Diagnos Res. 2017; 11(7): 27-31.
  25. D'Souza N, Rodrigues C, Mehta A. Molecular characterization of methicillin-resistant Staphylo-coccus aureus with emergence of epidemic clones of sequence type (ST) 22 and ST 772 in Mumbai, India. J Clinic Microbiol. 2010; 48(5): 1806-811.
Type of Study: Research | Subject: Immunology
Received: 2019/11/4 | Published: 2020/05/30

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | International Journal of Medical Laboratory

Designed & Developed by : Yektaweb