Volume 8, Issue 1 (February 2021)                   IJML 2021, 8(1): 62-69 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Sharifi A, Ghadiri A, Salimi A, Ghandil P, Esmaeili S. Evaluating the Distribution of (+ 2044G / A, R130Q) Rs20541 and (-1112 C / T) Rs1800925 Polymorphism in IL-13 Gene: An Association-Based Study with Asthma in Ahvaz, Iran. IJML 2021; 8 (1) :62-69
URL: http://ijml.ssu.ac.ir/article-1-371-en.html
Department of Immunology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
Full-Text [PDF 315 kb]   (954 Downloads)     |   Abstract (HTML)  (2255 Views)
Full-Text:   (963 Views)
Introduction
 
Asthma is a chronic inflammatory disorder of the airways system, and upon the Global Initiative for asthma (GINA) guidelines, uncontrolled cells and their mediators have the main role in inflammation, hyperresponsiveness, wheezing and breathlessness, coughing, chest tightness, and lung obstruction [1, 2]. It has also shown that the interaction of genetics and environmental factors led to ashma and some aspects of asthma are strongly followed by a hereditary pattern but not Mandli’s pattern [3-5]. In asthma patients, due to the dis-regulation of immune responses, especially the imbalance of inflammatory/anti-inflammatory cytokines, clinical signs of asthma are induced and developed [6, 7].
Cytokines are small glycoproteins that interact with specific receptors and stimulate or regulate the immune responses. The existence of polymorphisms in promoter region or encoding region of the cytokine or cytokine receptor genes could change their structure and function. Therefore, any polymorphism in these regions positively or negatively affects disease outcomes [8]. Interlukin (IL)-13 and IL-4 are the greatest Thelper (Th)2- secreted cytokine and have determinative roles in asthma disease pathogenesis [9]. IL-13 acts by affecting maturation and differentiation, increasing the expression of major histocompatibility complex II (MHCII) and CD23, and IgM to IgE isotype switching of the B-lymphocytes [10]. This cytokine could modulate macrophage activity and inhibit the production of pro-inflammatory cytokines/ chemokines such as IL-1α, IL-1β, IL-6, IL-8, and tumor necrosis factor (TNF)-α. Also, IL-13 leads to an increase in the differentiation of goblet cells, activation of fibroblasts, increased mucosal secretion, and hyperresponsiveness in bronchial tubes [11].
Several single nucleotide polymorphisms (SNPs) in association with allergic diseases such as asthma have been reported in the IL-13 gene. Therefore, the IL-13 gene can be considered a candidate for the development, progression, or clinical signs of asthma [12]. Currently, two SNP with biological function has been identified in the IL13 gene. One of SNP is in the promoter of the gene in the (-112C / T) region and seems to play a role in regulating the gene expression. The second SNP is located in the fourth exon of the IL-13 gene and causes the conversion of arginine to glutamine amino acid in codon 130, which is likely to play a role in the affinity of receptor binding [13]. We have investigated (+2044G/A, R130Q) rs20541 and (-1112 C/ T) rs1800925 polymorphisms in the IL-13 gene in this projectability of their SNPs on asthma.

Materials and Methods
Patients and healthy controls
Three hundred thirty-nine people enrolled in this study and divided into two groups. One hundred sixty-seven diagnosed asthmatic patients (84 women and 83 men), according to the GINA criteria in 2011, and 172 controls (161 women and 11 men). All patients enrolled in this study lived in Southwest of Iran (same race, same mean age) and were recruited from educational hospitals of Jundishapur University of Medical Sciences (Ahvaz, Iran). Upon symptoms and diagnostic criteria of GINA, asthma patients selected by specialist physicians and healthy people without any history or signs of asthma and other respiratory and allergic diseases were considered the control group. Informed consent was obtained from the patients and healthy controls. The Ethical Committee of the Jundishapur University of Medical Sciences approved this study (IR.AJUMS.REC.1392. 308).
Spirometry test
Circuit-close and circuit-open spirometry method was performed for all precipitations. The spirometry report sheet was adjusted according to the date and time of the spirometry, reason of test, family asthma history, smoking history, and room temperature, age, height, and sex. Besides, we considered as exclusion criteria: the usage of any allergy drugs and any history of autoimmune diseases also IgE titer antibodies in the patient group as well as no history of any allergies, asthma, IgE deficiency, or autoimmune diseases in the control group.
Sampling and DNA extraction
Blood samples (5 ml) from each patient and healthy control were collected into ethylenediamine tetraacetic acid (EDTA) tubes. DNA was extracted using a blood genomic DNA extraction mini kit (Yekta tajhiz azma, Iran) according to the manufacturer’s instructions (DNA Yield: 4~8 μg/ 200-μl whole blood). Nanodrop (America, Thermo Scientific) confirmed the purity of extracted DNA, and the ratio of relative absorbance at 260:280 OD was measured; after that, extracted DNA was stored at -20˚C to perform the genotyping test.
Genotyping Taqman real-time polymerase chain reaction (PCR)
The genotype of DNA samples of asthma patients and healthy control subjects was done by Taqman real-time PCR genotyping method, through specific probes of C-1112T IL-13 and G +2044A IL-13 (TaqMan™ SNP Genotyping Assay, human kit, USA) (Table 1) and using step one real-time PCR device (ABI, USA). In a sterile tube, 1 μl of diluted DNA (10 μg), 5 μl of Taqman Genotyping Master Mix, 0.14 μl of SNP IL-13 Probes (separately), and 3.86 μl of RNase-free water was added and adjusted in 10 μl total volume. After that, tubes underwent cycling conditions: 95˚C for 30 s, followed by 35 cycles at 95˚C for 5 s, and annealing and extension at 60˚C for 30 s.
Statistical analysis
Statistical analysis of the allelic distribution and genotype of the two polymorphisms in the patient and control groups was performed using the Chi-square test and SPSS-22 software. A P-value of less than 0.05 was considered significant.

Results
The information of sex and gender of the patient and healthy control groups and the information of forced expiratory volume in one second (FEV1), forced vital capacity (FVC), and FEV1/FVC ratio of the patient group were presented in Table 2. The results of determining the genotype of each polymorphism for wild homozygous, heterozygote,   and  mutants  homozygote  and allelic distribution were measured in patient and control groups using Chi-square test, and the risk ratio for allele distribution was calculated, and p < 0.05 were considered to be significant. The results of allelic and genotypic frequency for rs1800925 and rs20541 polymorphisms are presented in Table 3. In the present study, the frequency of wild homozygote genotypes for rs1800925 and rs20541 was 53.2% and 61% in the patient group and 66.2% and 53.4% control group, respectively. The frequency of mutant homozygous genotype for rs1800925 in the patient group was 10.7% and in the control group was 5.2%, and the frequency distribution of mutant homozygote genotype for rs20541 was observed 7.78% and 11% in the patient and control groups, respectively. In the patient group, the heterozygote genotype frequency of rs1800925 was 35.9% and 35.1% for rs20541, respectively, and in the healthy control group, the heterozygote genotype frequency of rs1800925 and rs20541 was 28.4% and 35.5%, respectively. Our results showed that rs1800925 polymorphism was associated with a significant increase of AA mutant homozygote genotype in the patient group compared to control (p=0.005), but is not significant for rs20541 polymorphism, and the frequency of mutant genotype in the healthy group was more than the patient group (p= -0.108). The genotypic distribution results in both males and females in the patients’ group are shown in Table 4. The distribution of genotypes in both sexes was approximately the same, and no difference was observed (p= -0.608) (Table 4).
 
 
Table 1. The Information of TaqMan probes for IL-13 -1112C/T and IL-13 +2044G/A polymorphisms
SNP ID rs1800925
Gene name Interleukin 13
Chromosome location Chr.5: 131992809
Polymorphism C/T, transition substitution
Context sequence [VIC/FAM]
GGTTTCTGGAGGACTTCTAGGAAAA[C/T]GAGGGAAGAGCAGGAAAAGGCGACA
SNP ID rs20541
Gene name Interleukin 13
Chromosome location Chr.5: 131995964
Polymorphism A/G, transition substitution
Context sequence [VIC/FAM]
TTAAAGAAACTTTTTCGCGAGGGAC[A/G]GTTCAACTGAAACTTCGAAAGCATC
 
Table 2. The information of the precipitated patient and healthy control subjects in the study
Case Control
Sex/ Age Male/ Female 83/84 11/161
1-20 6/5 3/16
21-40 50/47 6/82
41-60 22/29 2/54
61-80 5/3 0/9
FEV1 (Mean) 67.1%
FVC (Mean) 72.3%
FEV1/FVC (Mean) 74.7%
FEV1= Forced expiratory volume in one second; FVC= Forced vital capacity
 
 
 
Table 3. The results of allelic and genotypic frequency for IL-13 -1112C/T polymorphisms (A) and IL-13 +2044G/A polymorphisms (B)
(A)  Genotype                    Control                       Asthma p-value
IL-13 -1112C/T   N   % N    %  
Homozygus CC 114 66.27 89 53.2 0.028
Heterozygus CT 49 28.4 60 35.9
Homozygus TT 9 5.2 18 10.7
Freq All C 277  80.5 238 71.25 0.005
Freq All T 67 19.5 96 28.7
OR= 0.59 (0.419-0.8568)
(B) Genotype  Control                 Asthma  
+2044G/A IL-13 N % N %  
Homozygus GG 92 53.4 102 61 0.319
Heterozygus GA 61 35.5 52 31.1
Homozygus AA 19 11 13 7.78
Freq all G 245 71.2 256 76.6 0.108
Freq all A 99 28.7 78 23.3
OR= 1.32 (0.9396-1.8718)
 

Table 4. The Comparison of allele frequency of IL-13 -1112C / T and IL-13 + 2044 G / A polymorphisms with patients’ gender
Single nucleotide polymorphisms Allele Female N (%) Male p-value
CC 43 (27.7) 46 (27.5) 0.632
  -1112C/T IL-13 CT 33(19.8) 27 (16.2)
TT 8 (4.8) 10(6)
GG 51 (30.5) 51 (30.5) 0.608
+2044G/A IL-13 GA 28 (16.8) 24 (14.4)
AA 5 (3) 8 (4.8)
 
Discussion
IL-13 as a Th2- secreted cytokine is one of the main cytokines in asthma and is responsible for asthma’s physiological and pathological events, including airway hyperresponsiveness, and airway remodeling. Besides, IL-13 can facilitate the differentiation and survival of eosinophils and mast cells, enhance IgM to IgG isotype switching and increase mucus secretion [9, 14]. Studies have shown that the IL-13-immunological pathway can be considered a therapeutic target in asthma, and also the administration of Lebrikizumab, IL-13 monoclonal antibody, in asthma-resistant individuals could improve and relieve asthma symptoms and increased the FEV1 [15].
IL-13 has been widely studied for its role in asthma, and some genetic studies point to the potential role of this cytokine in asthma and the effect of multiple polymorphisms of this gene regarding asthma in humans [16-18]. The most important IL-13 polymorphisms are IL-13-1112C/T, in the promoter gene region, and IL-13+2044 G/A, in the fourth exon of the IL-13 gene, which have been studied in several exercises and were associated with inconsistent results [19].
IL-13-1112C/T polymorphism could increase the expression of IL-13 in Th2 cells and increase the secretion of this cytokine through stimulated mononuclear cells by mitogens [20]. On the other hand, IL-13 + 2044A / G polymorphism probably affected IL13 function, and studies have shown that the AA genotype of this polymorphism leads to a decrease of IL-13 affinity to binding IL-13Rα2 [21]. Therefore, the role of these polymorphisms is acceptable in increasing asthma sensitivity. The current study evaluated the comparison of frequency and distribution of genotyping of IL-13 -1112C / T and IL-13+2044G/A polymorphisms with asthma. Based on the results, IL-13 -1112C / T polymorphism can be considered a risk factor for asthma, but the present study’s results showed no association between IL-13+2044G/A  polymorphism and asthma.
Previous studies have shown the relationship between genetic variation in the IL-13 promoter region (IL-13 -1112C / T), RANTES genes, and leukotriene C4S with asthma and atopy on African Americans, indicating that this SNP can be used as a prognostic marker of asthma and atopy [22]. The current study also confirmed that IL-13 -1112C / T polymorphism is a risk factor for asthma. On the contrary, the other study evaluates the association of children’s asthma, IgE level, and eosinophil with IL-13 polymorphisms in white Costa Rican children. It showed that the T allele of -1112 polymorphism only contributed to asthma’s progress in corticosteroids consuming asthma children and did not affect asthma risk. Regarding IL-13+2044G/A polymorphisms, the A allele of this polymorphism was associated with an increase of IgE level and eosinophil, but no relation with asthma [23] showed that this polymorphism had no significant association with the disease in this study.  Studies on IL-4 gene promoter (-590C > T) and IL-16 gene promoter (-295T > C) polymorphisms showed a significant correlation between IL-13 (R130Q) coding region polymorphisms and IL-4 gene promoter (-590C > T) with asthma disease in Tehran [24]. A cohort study on 2918 individuals to evaluate the relationship between genetic diversity of IL-13 and asthma, allergies and hay fever revealed a significant correlation between IL-13 -1112C / T polymorphism and IL-13+2044G/A, Q130R polymorphism with asthma and allergy. Results showed +2044G/A, Q130R polymorphism interfered with -1112C/T polymorphism function, and -1112C/T polymorphism did not have an independent role concerning asthma [25]. In our study, we did not find a significant association between +2044G/A and asthma. Besides, a comprehensive meta-analysis study revealed a meaningful relationship between +2044G/A and -1112C / T polymorphisms with the risk of Asthma [26]. The current project results showed the relationship between -1112C / T polymorphism and asthma, but we did not find any significant statistical difference between patient and control groups regarding genotype and allelic distribution of +2044G/A polymorphism with asthma, although the mentioned studies have reported this relationship. In other hand, mentioned markers can be just a sign and they are not the only direct cause of asthma in the population, therefore these outcomes also could be due to differences in the genetics of the Iranian population. Our suggestion to achieve better results is investigating other polymorphisms of IL13 cytokine, the measure of IL13 serum levels along with other polymorphisms and increase the sample size.

Conclusion
We showed that a significant  IL-13 -1112C / T polymorphism in the ashma positively correlates with the induction of asthma while the IL13 + 2044G / A polymorphism results showed no significant difference between the ashma and control groups. Therefore, evaluation of these polymorphisms potentially can use to predict or control of disease sign. 

Conflict of Interest
The authors declare that there are no conflicts of interest.

Acknowledgments
The authors thank the Vice President of the Research Council of Ahvaz University of Medical Sciences (AJUMS; grant number: N-102).
  
References
  1.  Killeen K, Skora E. Pathophysiology, diagnosis, and clinical assessment of asthma in the adult. Nursing Clinics 2013; 48(1): 11-23.
  2.  Tenn MW, Steacy LM, Ng CC, Ellis AK. Onset of action for loratadine tablets for the symptomatic control of seasonal allergic rhinitis in adults challenged with ragweed pollen in the Environmental Exposure Unit: a post hoc analysis of total symptom score. Allergy, Asthma & Clinical Immunology 2018; 14(1): 5.
  3.  Pedersen SE, Hurd SS, Lemanske Jr RF, Becker A, Zar HJ, Sly PD ,et al. Global strategy for the diagnosis and management of asthma in children 5 years and younger. Pediatric pulmonology 2011; 46(1): 1-17.
  4.  Baldini M, Carla Lohman I, Halonen M, Erickson RP, Holt PG, Martinez FD. A Polymorphism* in the 5′ flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E. Am J Respirat Cell Mol Biol. 1999; 20(5): 976-83.
  5.  Rennie DC, Karunanayake CP, Chen Y, Nakagawa K, Pahwa P, Senthilselvan A, et al. CD14 gene variants and their importance for childhood croup, atopy, and asthma. Dis Markers. 2013; 35(6): 765-71.
  6. Garth J, Barnes J, Krick S. Targeting cytokines as evolving treatment strategies in chronic inflammatory airway diseases. Int J Mol Sci. 2018; 19(11): 3402.
  7.  Lodin K, Lekander M, Syk J, Alving K, Petrovic P, Andreasson A. Longitudinal co-variations between inflammatory cytokines, lung function and patient reported outcomes in patients with asthma. PloS One 2017; 12(9): 185019.
  8.  Howell WM, Rose-Zerilli MJ. Cytokine gene polymorphisms, cancer susceptibility, and prognosis. J Nutr. 2007; 137(1): 194-99.
  9.  Doran E, Cai F, Holweg CT, Wong K, Brumm J, Arron JR. Interleukin-13 in asthma and other eosinophilic disorders. Frontiers Med. 2017;4(1):139.
  10.  Turqueti-Neves A, Otte M, Schwartz C, Schmitt MER, Lindner C, Pabst O, et al. The extracellular domains of IgG1 and T cell-derived IL-4/IL-13 are critical for the polyclonal memory IgE response in vivo. PLoS Biol. 2015; 13(11): 1002290.
  11.  Corren J. Anti-interleukin-13 antibody therapy for asthma: one step closer. Eur Respir J. 2013; 41(1): 255-56.
  12.  Xu Y, Li J, Ding Z, Li J, Li B, Yu Z, et al. Association between IL-13+ 1923C/T polymorphism and asthma risk: a meta-analysis based on 26 case-control studies. Bioscience Reports 2017; 37(1): 20160505.
  13.  Hiromatsu Y, Fukutani T, Ichimura M, Mukai T, Kaku H, Nakayama H, et al. Interleukin-13 gene polymorphisms confer the susceptibility of Japanese populations to Graves’ disease. J Clin Endocrinol Metabol. 2005; 90(1): 296-301.
  14.  Corren J. Role of interleukin-13 in asthma. Curr Allergy Asthma Rep. 2013; 13(5): 415-20.
  15.  Ingram JL, Kraft M. IL-13 in asthma and allergic disease: asthma phenotypes and targeted therapies. J Allergy Clin Immunol. 2012; 130(4): 829-42.
  16.  Tsai CH, Tung KY, Su MW, Chiang BL, Chew FT, Kuo NW, et al. Interleukin-13 genetic variants, household carpet use and childhood asthma. PLoS One 2013; 8(1): 51970.
  17. Torgerson DG, Ampleford EJ, Chiu GY, Gauderman WJ, Gignoux CR, Graves PE, et al. Meta-analysis of genome-wide association studies of asthma in ethnically diverse North American populations. Nature Gen. 2011; 43(9): 887.
  18. Song GG, Lee YH. Pathway analysis of genome-wide association study on asthma. Human Immunol. 2013; 74(2): 256-60.
  19. Mei Q, Qu J. Interleukin-13+ 2044 G/A and+ 1923C/T polymorphisms are associated with asthma susceptibility in Asians: A meta-analysis. Medicine 2017; 96(51): 9203.
  20.  Cameron L, Webster RB, Strempel JM, Kiesler P, Kabesch M, Ramachandran H, et al. Th2 cell-selective enhancement of human IL13 transcription by IL13-1112C> T, a polymorphism associated with allergic inflammation. J Immunol. 2006; 177(12): 8633-642.
  21.  Arima K, Sato K, Tanaka G, Kanaji S, Terada T, Honjo E, et al. Characterization of the interaction between interleukin-13 and interleukin-13 receptors. J Biologic Chem. 2005; 280(26): 24915-4922.
  22. Moissidis I, Chinoy B, Yanamandra K, Napper D, Thurmon T, Bocchini Jr J, et al. Association of IL-13, RANTES, and leukotriene C4 synthase gene promoter polymorphisms with asthma and/or atopy in African Americans. Geneti Med. 2005; 7(6): 406.
  23. Hunninghake GM, Soto-Quirós ME, Avila L, Su J, Murphy A, Demeo DL, et al. Polymorphisms in IL13, total IgE, eosinophilia, and asthma exacerbations in childhood. J Allergy Clin Immunol. 2007; 120(1): 84-90.
  24.  Hosseini-Farahabadi S, Tavakkol-Afshari J, Rafatpanah H, Farid-Hosseini R, Daluei MK. Association between the polymorphisms of IL-4 gene promoter (-590C> T), IL-13 coding region (R130Q) and IL-16 gene promoter (-295T> C) and allergic asthma. Iran J Allergy, Asthma Immunol. 2007; 6(1): 9-14.
  25. Black S, Teixeira A, Loh A, Vinall L, Holloway J, Hardy R, et al. Contribution of functional variation in the IL13 gene to allergy, hay fever and asthma in the NSHD longitudinal 1946 birth cohort. Allergy 2009; 64(8): 1172-178.
  26.  Liu Y, Liu T, Nie W, Lai G, Xiu Q. Interleukin-13+ 1923C/T polymorphism is associated with asthma risk: a meta-analysis. BioMed Res Int. 2013; 394316(1): 1-9.
Type of Study: Research | Subject: Immunology
Received: 2020/07/26 | Accepted: 2021/02/24 | Published: 2021/03/4

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | International Journal of Medical Laboratory

Designed & Developed by : Yektaweb