Volume 10, Issue 2 (May 2023)                   IJML 2023, 10(2): 157-165 | Back to browse issues page


XML Print


Download citation:
BibTeX | RIS | EndNote | Medlars | ProCite | Reference Manager | RefWorks
Send citation to:

Ghanbari F, Abedpoor N, Peymani M, Asadi-Yousefabad S, Lotfi M, Sheikhha M H et al . Effects of the Phytocompound Combination against Dysbiosis Induced by AGE-Rich High-fat Diet in Mice. IJML 2023; 10 (2) :157-165
URL: http://ijml.ssu.ac.ir/article-1-476-en.html
Department of Medical Genetics, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran
Full-Text [PDF 671 kb]   (678 Downloads)     |   Abstract (HTML)  (1499 Views)
Full-Text:   (749 Views)
Introduction
Advanced glycation end products (AGEs) are a heterogeneous class of products generated by non-enzymatic reactions between free amino acids/ lipids/ nucleic acids/ and α-dicarbonyl or sugars [1]. Aging can lead to the accumulation of endogenous AGEs and oxidative stress. Furthermore, the sources of exogenous AGEs, such as smoking and diet, considerably increase their amount in the body [2]. The nutritional composition (protein, fat, and carbohydrate) and conditions of cooking (high temperature, high pH, and long-time cooking) are the most important dietary factors determining AGEs [3]. A diet high in AGEs is closely related to some pathogenic mechanisms, including low-grade inflammation, dysfunction of endothelium, and oxidative stress, responsible for chronic disorder onsets such as diabetes, cardiovascular diseases, cancer, and renal disease [4, 5]. The intestinal microbiota may metabolize some dietary AGEs not defecated and absorbed. Afterward, the role of residual AGEs has attracted attention as a possible link to the composition of the gut microbiota. [4]. The microbiota of the gut is a very complex and dynamic ecosystem, and its homeostasis maintenance is important for the health of humans. Composition imbalances of the gut microbiota might damage the function of the gut barrier and increment the endotoxins level in the bloodstream leading to endotoxemia of metabolic [6]. Recent animal research has offered that diets enriched with AGEs are related to changes in intestinal microbiota composition, such as a reduction in the abundance of Lactobacilli, Bacteroidetes, and Bifidobacteria [7, 8]. Considering these proposes, the efficacy of gut microbiota can be improved following the usage of some dietary supplements, including herbal extracts, due to their active ingredients from plants which can change the level of beneficial bacteria and the production of the metabolites in the gut [9, 10]. The rhizome of Turmeric (Curcuma longa) is widely consumed as a dietary spice and coloring agent, particularly in Asia. Curcumin is the main active constituent of turmeric. It is a polyphenol component that has increasingly received attention for medical applications and pharmacological activities [11, 12]. Previous studies showed that the administration of curcumin may result in effects of regulative on the microbiota community [13]. Furthermore, the rhizome of ginger (Zingiber officinale Roscoe) has been commonly valued as a spice and an herbal remedy for a long time [14]. Various bioactive compounds have been known in ginger, such as terpene and phenolic compounds. Recently, ginger has attracted increasing attention owing to biological activities such as antioxidant, neuroprotective, anti-inflammatory, and antibacterial activities [15]. Additionally, the gum resin of Boswellia trees has been utilized for treating various infectious and inflammatory diseases in herbal medicine [16]. Among different constituent varieties of Boswellia species, Boswellic acids (pentacyclic triterpene acids) accounts for the pharmacologically active substances [17]. Also, scientific research into Uncaria tomentosa (cat’s claw) extracts and constituents has revealed some therapeutic properties, such as immunomodulating, antioxidant, anti-inflammatory, antiviral, and anti-microbial activities [18]. The objectives of the current study were first to assess changes in gut microbiota by AGEs diet, then ameliorative effects of the Phyto Compound (Turmeric, ginger, Boswellia, and Uncaria tomentosa) against dysbiosis in mice.
Materials and Methods
Experimental design
Male C57BL/6 mice (2-month-old; 14±3 g) were purchased from the Royan Institute for Biotechnology (Isfahan, Iran), maintained under standard conditions: 45–55% humidity and 23–24 °C temperature, also a dark-light cycle of 12 hours, After one week of acclimation feeding, 18 mice were randomly divided to three groups: regular diet (ND) fed with pellet diets and water ad libitum (control group; n= 6), AGE-rich high-fat diet (HFD) (n= 6), AGE-rich HFD and plant extract (PE) 0.6 mg/g (HFD/PE; n= 6) 16 weeks. The Ethics Committee of the Royan Institute accepted all protocols of animal practice. 
Preparation of PE
Phyto Arthrit, a combination of four plants powder: turmeric (31%), ginger (29.5%) and, Boswellia (29.5%), Uncaria tomentosa (10%) were prepared from Goldaro Pharmaceutical Company (Isfahan, Iran), was dissolved in distilled water and daily gavaged to mice for 8 weeks.
Fecal DNA extraction
Fecal samples were collected in the 17th week. Samples in the cold chain were immediately transferred to the laboratory for storage. These samples were kept at -80 °C upon arrival until further processing. Bacterial fecal DNA was isolated using the QIAamp DNA Stool Mini Kit (Qiagen Retsch GmbH, Hannover, Germany) according to the manufacturer’s protocol. The integrity and length of the extracted bacterial DNA of samples have assessed the usage of gel electrophoresis (Fig. 1), and concentration and purity were determined using a Nanodrop spectrophotometer (Thermo Scientific, USA). The extracted overall DNA turned into saved at -20 °C.
quantitative polymerase chain reaction (qPCR) analyses of 16S rDNA
Bacterial abundance was analyzed using SYBER green qPCR (Light Cycler® 96 SW 1.1; Roche, Germany) [19, 20]. Each qPCR reaction consisted of the DNA template (1 µl), SYBR Premix Ex Taq II (Takara, Japan), and 0.5 µl of specific16s rDNA primers (Table 1) for each bacterium and was conducted in triplicate. The amplification program was run as follows: 95 °C for 60 seconds (1 cycle), followed by denaturation at 95 °C for 5 seconds (40 cycles), annealing at 55 °C for 30 seconds, and extension at 72 °C for 30 seconds. Then, melting curve analysis was performed to control the specificity of the PCR reaction, followed by 1 cycle at 94 °C for 5 seconds, 60 °C for 60 seconds, and 94 °C for 1 second (Fig. 2). Each sample’s threshold cycle (ct) is registered by the thermocycler.
Standard curve
A standard curve was generated using serial dilutions of DNA from a standard strain of Escherichia coli that was used to calculate the DNA concentration of each bacterium from stool samples. The standard curve is a semi-log regression line plot of computerized tomography versus log DNA concentration. Then the number of template copies was determined by using the online formula in (cels.uri.edu/gsc/cndna.html).
Statistical analysis
GraphPad Prism Software (Version 9.0 Graph Pad Software Inc., USA) was used to determine mean differences between the groups. Data were triplicate data sets for each sample and were analyzed by One-way analysis of variance (ANOVA). p < 0.05 was considered statistically significant.
Results
PE improved the gut microbiota in AGE-rich HFD
Compared with the control group, HFD treatment decreased the relative abundance of Bacteroidetes (p = 0.001), Bifidobacterium (p = 0.0008), A. muciniphila (p = 0.0005), and F. prausnitzii (p < 0.0001), and increased the relative abundance of Firmicutes. In contrast, PE treatment improved their relative abundance of them (Fig. 3).
F/B ratio
Our results showed that the abundances of Firmicutes and Bacteroidetes were significantly increased in the AGE-rich HFD group and decreased in the AGE-rich HFD/PE group. Besides, the F/B ratio was significantly higher in the AGE-rich HFD (p = 0.0003) than in the control group (Fig. 3).
Table 1. 16S rRNA gene-specific primers for the studied bacterial group/species
Primers Sequence (5′–3′) Amplicon size (bp) Reference
Firmicutes TGAAACTYAAGGAATTGACG
ACCATGCACCTGTC
155 [45]
Bacteroidetes CTGAACCAGCCAAGTAGCG CCGCAAACTTTCACAACTGACTTA 230 [46]
Bifidobacterium TCGCGTCYGGTGTGAAAG CCACATCCAGCRTCCAC 128 [46]
Akkermansia muciniphila CAGCACGTGAAGGTGGGGAC CCTTGCGGTTGGCTTCAGAT 327 [46]
Faecalibacterium prausnitzii GGAGGAAGAAGGTCTTCGG AATTCCGCCTACCTCTGCACT 248 [46]
Escherichia coli CATTGACGTTACCCGCAGAAGAAGC CTCTACGAGACTCAAGCTTGC 195 [46]

Fig. 1. Stool DNA extracted from samples
Fig. 2. Melt curve from qPCR of the 16srDNA gene


Fig. 3. The abundance of vital microbiota in each group. AGEs= Advanced glycation end products; AGE/Phto= AGEs/ Phyto extracts. *p < 0.05
Discussion
There is increasing evidence that the microbiota plays a key role in maintaining host health. Accordingly, any perturbations in gut microbiota composition, such as the decrease in diversity and prevalence of bacteria, can cause the progression of many human diseases, such as inflammatory bowel disease, obesity, diabetes, asthma, allergies, neuro-inflammation, and depression [21-24]. The composition of Microbiota can be influenced by various environmental and lifestyle factors, including diet, which significantly impacts gut microbiota diversity [23, 25, 26]. A large body of evidence revealed that the modern lifestyle with AGEs rich western diet by perturbations in the microbiota composition of the gut and reducing bacterial diversity (dysbiosis), provides a basis for the dysfunction of the immune system, then causes altered intestinal permeability and low-grade systemic inflammation [3, 27, 28]. This experiment aimed to investigate the relationship between the consumption of AGE-rich HFD and intestinal microbiota and then assess the effects of PE on gut dysbiosis induced by HFD. For this purpose, mice were first subject to AGE for a long time (16 weeks); at the same time, PE was gavage to mice in the eighth week. Our results demonstrated that the F/B ratio in the HFD group significant increase than to the ND group. The abundance of Bifidobacterium, Bacteroidetes, A. muciniphila and, F. prausnitzii was significantly decreased, whereas the frequency of Firmicute was significantly increased in the AGE-rich HFD group. In comparison, PE reduced her F/B ratio and improved gut microbiota homeostasis. In line with our study, Wang et al. reported that treatment of mice with high-AGE diets leads to reduced diversities of the gut microbiota. They also showed that the abundance of butyrate-producing bacteria such as Lachnospiraceae, Bacteroidales, and Ruminococcaceae decreased after an AGE-rich diet [4]. Loss of butyrate-producing bacteria has been speculated to lead to intestinal epithelial barrier dysfunction, immune stimulation, and low-grade systemic inflammation [5, 29]. Also, Hassan et al., in agreement with our results, reported that long-term HFD in mice decreased the relative prevalence of Bacteroidetes. Likewise, the Firmicutes to Bacteroidetes ratio, as found in obese mice and humans, was increased in response to HFD [30]. Seiquer et al. showed that the possible effects of the AGEs diet on the composition of gut bacteria depend on the amount and chemical structure of the different compounds [31]. Recent experiments have provided direct and indirect evidence that isolated compounds of plant extracts are potent modulators of gut microbiota composition [32, 33]. The plant extract used in this study comprises turmeric, Boswellia, ginger, and cat’s claw which have already been testified for different biological functions, such as antibacterial, anti-inflammatory, antioxidant, antitumor, and neuroprotective [34-37]. Previous studies show curcumin exerts direct regulatory effects on the intestinal microbiota [21]. Curcumin can alter the ratio of beneficial to harmful bacteria in the intestinal microbiota community in favor of beneficial bacteria such as butyrate-producing bacteria, bifidobacterial, and lactobacilli. It also decreases the abundance of pathogenic bacteria such as Prevoellaceae, Coriobacterales, Rikenellaceae, and Enterobacteria, commonly associated with developing systemic diseases [38-41]. Shen et al. demonstrated that oral curcumin administration in C57BL/6 mice significantly altered the abundance of several pathogenic families, such as Bacteroidaceae, Prevotellaceae, and Rikenellaceae [39]. Wang et al. revealed that ginger treatment in HFD-fed mice modulates the intestinal microbiota composition and increases species of bifidobacteria and SCFA-producing bacteria (Alloprevotella and Allobaculum). [42]. Suther et al. observed that the administration of Boswellia serrata to mice for 14 days showed a significant reduction in the number of gut bacteria in male mice, with no effect in female mice [43].
Conclusion
In the present study, HFD altered gut microbiota composition in mice treated with AGE-rich HFD compared to control, while consumption of the PE compound could ameliorate gut dysbiosis. Modulation of the gut microbiota by dietary interventions such as plant extracts as modifiable targets has increased in recent years, both in research interest and product development. However, it seems more studies are required to prove the application of plant extract for modulating the gut microbiota as a promising new biomarker with potential for therapeutic applications.
Conflict of Interest
The authors declare that they have no competing interests.
Acknowledgment
We thank our colleagues at the Royan Institute of Isfahan for their association and helpful discussions in this study.

References

[1]. Qu W, Yuan X, Zhao J, Zhang Y, Hu J, Wang J, et al. Dietary advanced glycation end products modify gut microbial composition and partially increase colon permeability in rats. Mol Nutr Food Res. 2017; 61(10): 1700118.
[2]. Moldogazieva NT, Mokhosoev IM, Mel'nikova TI, Porozov YB, Terentiev AA. Oxidative Stress and advanced lipoxidation and glycation end products (ALEs and AGEs) in aging and age-related diseases. Oxid Med Cell Longev. 2019; 8: 3085756.
[3]. Uribarri J, Woodruff S, Goodman S, Cai W, Chen X, Pyzik R, et al. Advanced glycation end products in foods and a practical guide to their reduction in the diet. J Am Dietetic Association 2010; 110(6): 911-16.
[4]. Wang J, Cai W, Yu J, Liu H, He S, Zhu L, et al. Dietary advanced glycation end products shift the gut microbiota composition and induce insulin resistance in mice. Diabetes Metab Syndr Obes. 2022; 1(2):427-37.
[5]. Mastrocola R, Collotta D, Gaudioso G, Le Berre M, Cento AS, Ferreira Alves G, et al. Effects of exogenous dietary advanced glycation end products on the cross-talk mechanisms linking microbiota to metabolic inflammation. Nutrients 2020; 19; 12(9): 2497.
[6]. Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D, et al. Metabolic endotoxemia initiates obesity and insulin resistance. Diabetes 2007; 56(7): 1761-772.
[7]. Zhang Z, Li DJM. Thermal processing of food reduces gut microbiota diversity of the host and triggers adaptation of the microbiota: evidence from two vertebrates. Microbiome 2018; 6(1): 1-4.
[8]. Marungruang N, Fåk F, Tareke EJN, metabolism. Heat-treated high-fat diet modifies gut microbiota and metabolic markers in apoe−/− mice. J Nutr Metab. 2016; 13: 1-11.
[9]. Bindels LB, Delzenne NM, Cani PD, Walter J. Towards a more comprehensive concept for prebiotics. Nat Rev Gastroenterol Hepatol. 2015; 12(5): 303-310.
[10]. Tremaroli V, Bäckhed FJN. Functional interactions between the gut microbiota and host metabolism. Nature 2012; 489(7415): 242-49.
[11]. Yusuf M, Hassan MA, Tag HM, Sarivistava K, Reddy PG, Hassan AM. Influence of turmeric (Curcuma longa) on performance, histo-morphology and microbiota of intestine in juvenile tilapia (Oreochromis niloticus). Int J Agric Sci Vet Med. 2017; 5(1): 7-16.
[12]. Scazzocchio B, Minghetti L, D’Archivio M. Interaction between gut microbiota and curcumin: a new key of understanding for the health effects of curcumin. Nutrients 2020; 12(9): 2499.
[13]. Jabczyk M, Nowak J, Hudzik B, Zubelewicz-Szkodzińska B. Curcumin and its potential impact on microbiota. Nutrients 2021; 13(6): 2004.
[14]. Han YA, Song CW, Koh WS, Yon GH, Kim YS, Ryu SY, et al. Antiinflammatory effects of the Zingiber officinale roscoe constituent 12dehydro-gingerdione in lipopolysaccharide stimulated Raw 264.7 Cells. Phytother Res. 2013; 27(8): 1200-205.
[15]. Mao QQ, Xu XY, Cao SY, Gan RY, Corke H, Beta T, Li HB. Bioactive compounds and bioactivities of ginger (Zingiber officinale Roscoe). Foods 2019; 8(6): 185.
[16]. Poeckel D, Werz O. Boswellic acids: biological actions and molecular targets. Curr Med Chem. 2006; 13(28): 3359-369.
[17]. Ammon HP. Boswellic acids in chronic inflammatory diseases. Planta Med. 2006; 72(12): 1100-116.
[18]. Blanck JJ, Huebner TM, Rolls AM, Cornell JS, Hwang CSJA. Comprehensive review of the components in cat’s claw (Uncaria tomentosa) and their antibacterial activity. Appl Chem. 2022; 2(1): 1-29.
[19]. Collado MC, Derrien M, Isolauri E, de Vos WM, Salminen S. Intestinal integrity and Akkermansia muciniphila, a mucin-degrading member of the intestinal microbiota present in infants, adults, and the elderly. Appl Environ Microbiol. 2007; 73(23): 7767-770.
[20]. Benus RF, van der Werf TS, Welling GW, Judd PA, Taylor MA, Harmsen HJ, et al. Association between Faecalibacterium prausnitzii and dietary fibre in colonic fermentation in healthy human subjects. Br J Nutr. 2010; 104(5): 693-700.
[21]. Scazzocchio B, Minghetti L, D'Archivio M. Interaction between gut microbiota and curcumin: A new key of understanding for the health effects of curcumin. Nutrients 2020; 19; 12(9): 2499.
[22]. Phuong-Nguyen K, McNeill BA, Aston-Mourney K, Rivera LRJN. Advanced glycation end-products and their effects on gut health. Nutrients 2023; 15(2): 405.
[23]. Zeb F, Osaili T, Obaid RS, Naja F, Radwan H, Cheikh Ismail L, et al. Gut microbiota and time-restricted feeding/eating: A targeted biomarker and approach in precision nutrition. Nutrients 2023; 15(2): 259.
[24]. Pan W, Zhao J, Wu J, Xu D, Meng X, Jiang P, et al. Dimethyl itaconate ameliorates cognitive impairment induced by a high-fat diet via the gut-brain axis in mice. Microbiome. 2023; 11(1): 30.
[25]. Bruce-Keller AJ, Salbaum JM, Luo M, Blanchard Et, Taylor CM, Welsh DA, et al. Obese-type gut microbiota induce neurobehavioral changes in the absence of obesity. Biol Psychiatry. 2015; 77(7): 607-15.
[26]. Almeida C, Oliveira R, Soares R, Barata P. Influence of gut microbiota dysbiosis on brain function: a systematic review. Porto Biomed J. 2020; 5(2): 1-8.
[27]. Wu H, Zhang W, Huang M, Lin X, Chiou J. Prolonged high-fat diet consumption throughout adulthood in mice induced neurobehavioral deterioration via gut-brain axis. Nutrients 2023; 15(2): 392.
[28]. Snelson M, Coughlan MT. Dietary advanced glycation end products: digestion, metabolism and modulation of gut microbial ecology. Nutrients 2019, 11 (2): 215.
[29]. Qu W, Nie C, Zhao J, Ou X, Zhang Y, Yang S, et al. Microbiome-metabolomics analysis of the impacts of long-term dietary advanced-glycation-end-product consumption on c57bl/6 mouse fecal microbiota and metabolites. J Agric Food Chem. 23; 66(33): 8864-875.
[30]. Hassan AM, Mancano G, Kashofer K, Fröhlich EE, Matak A, Mayerhofer R, et al. High-fat diet induces depression-like behaviour in mice associated with changes in microbiome, neuropeptide Y, and brain metabolome. Nutr Neurosci. 2019; 22(12): 877-93.
[31]. Seiquer I, Rubio LA, Peinado MJ, Delgado-Andrade C, Navarro MP. Maillard reaction products modulate gut microbiota composition in adolescents. Mol Nutr Food Res. 2014; 58(7): 1552-560.
[32]. Pferschy-Wenzig EM, Pausan MR, Ardjomand-Woelkart K, Röck S, Ammar RM, Kelber O, et al. Medicinal plants and their impact on the gut microbiome in mental health: A systematic review. Nutrients 2022; 14(10): 2111.
[33]. Pérez-Burillo S, Hinojosa-Nogueira D, Pastoriza S, Rufián-Henares JA. Plant extracts as natural modulators of gut microbiota community structure and functionality. Heliyon 2020; 6(11): 5474.
[34]. Moon M, Kim HG, Choi JG, Oh H, Lee PK, Ha SK, et al. 6-Shogaol, an active constituent of ginger, attenuates neuroinflammation and cognitive deficits in animal models of dementia. Biochem Biophys Res Commun. 2014; 449(1): 8-13.
[35]. Sandoval M, Okuhama N, Zhang XJ, Condezo L, Lao J, Angeles F, et al. Anti-inflammatory and antioxidant activities of cat’s claw (Uncaria tomentosa and Uncaria guianensis) are independent of their alkaloid content. Phytomedicine 2002; 9(4): 325-37.
[36]. Gomaa AA, Makboul RM, Al-Mokhtar MA, Nicola MA. Polyphenol-rich Boswellia serrata gum prevents cognitive impairment and insulin resistance of diabetic rats through inhibition of GSK3β activity, oxidative stress and pro-inflammatory cytokines. Biomed Pharmacother. 2019; 109: 281-92.
[37]. Sutalangka C, Wattanathorn J. Neuroprotective and cognitive-enhancing effects of the combined extract of Cyperus rotundus and Zingiber officinale. BMC Complement Altern Med. 2017; 17: 135.
[38]. Geurts L, Lazarevic V, Derrien M, Everard A, Van Roye M, Knauf C, et al. Altered gut microbiota and endocannabinoid system tone in obese and diabetic leptin-resistant mice: impact on apelin regulation in adipose tissue. Front Microbiol. 2017; 61(1): 1361780.
[39]. Shen L, Liu L, Ji HF. Regulative effects of curcumin spice administration on gut microbiota and its pharmacological implications. Food Nutr Res. 2017; 61(1): 1361780.
[40]. McFadden RM, Larmonier CB, Shehab KW, Midura-Kiela M, Ramalingam R, Harrison CA, et al. The Role of curcumin in modulating colonic microbiota during colitis and colon cancer prevention. Inflamm Bowel Dis. 2015; 21(11): 2483-494.
[41]. Le Chatelier E, Nielsen T, Qin J, Prifti E, Hildebrand F, Falony G, et al. Richness of human gut microbiome correlates with metabolic markers. Nature 2013. 29; 500(7464): 541-46.
[42]. Wang J, Wang P, Li D, Hu X, Chen F. Beneficial effects of ginger on prevention of obesity through modulation of gut microbiota in mice. Eur J Nutr. 2020; 59: 699-718.
[43]. Suther C, Daddi L, Bokoliya S, Panier H, Liu Z, Lin Q, et al. Dietary boswellia serrata acid alters the gut microbiome and blood metabolites in experimental models. Nutrients 2022; 14(4): 814.
Type of Study: Research | Subject: Bactriology
Received: 2023/03/19 | Accepted: 2023/05/31 | Published: 2023/05/31

Add your comments about this article : Your username or Email:
CAPTCHA

Send email to the article author


Rights and permissions
Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.

© 2026 CC BY-NC 4.0 | International Journal of Medical Laboratory

Designed & Developed by : Yektaweb